Гепатит у кошки: Гепатит кошек — симптомы, причины и лечение гепатита у кошек в Москве. Ветеринарная клиника «Зоостатус»

Содержание

Гепатит у кошек: симптомы, лечение и профилактика

Гепатит у кошек и котов, как правило, протекает довольно сложно, так как это воспалительный процесс, происходящий в тканях печени. Как и любое воспаление, которое нарушает нормальное функционирование пораженных тканей, гепатит приводит к тому, что печень практически «не работает». А если знать все функции, которые выполняет этот орган, то становится понятно, откуда берутся те или иные симптомы заболевания. Сегодня мы расскажем подробно о видах, причинах, симптомах и способах лечения гепатита у кошек.

Функции печени

Давайте начнем с основ, для того чтобы понимать весь масштаб ситуации. Разберемся в том, какие функции выполняет печень и у кошек.

Пищеварительная и регулирующая обмен веществ

Печень также участвует в процессе пищеварения, хотя точнее сказать, что этот орган – связующее звено между пищеварительной и кровеносной системами. Белки и жиры расщепляются благодаря работе печени (однако она не только расщепляет поступающие вещества, но и образует новые, необходимые для жизнедеятельности). Не стоит забывать и про гликоген, который запасает до «черных дней». К тому же печень регулирует выброс гормонов (в частности, адреналина и норадреналина).

Образование и выделение желчи

А выводится она в двенадцатиперстную кишку. Именно она помогает расщеплять пищу (однако она выполняет еще несколько функций, о которых вы узнаете из текста ниже). Желчь образуется в клеточках печени, используя для этого кровь. Когда гемоглобин разрушается, образуется билирубин, который и является желчным пигментом. Желчь помогает активизировать ферменты (в частности, липазу), которые и расщепляют пищу.

Всасывание жиров и синтез витаминов

Скорее эту функцию можно «присвоить» желчи, которая (как уже было написано выше) эмульгирует жиры. А вот они могут всосаться только после того, как соединятся с желчными кислотами. После того, как желчный пузырь «отдаст» скопившийся в нем секрет, кишечник начинает лучше сокращаться (перистальтика усиливается, что способствует нормальному продвижению пищи по ЖКТ).

В печени образуется витаминка А, а также «складируется» витамин К и «никотинка».

Регулирование уровня глюкозы в крови

Из предыдущего пункта «вытекает» следующая функция печени – регулирование уровня глюкозы в крови. Как только он повышается, печень сразу же начинает делать «запасы», образуя и откладывая гликоген. Когда же глюкозы не хватает, эти запасы разрушаются, в результате в крови сахар приходит в норму. Однако если у питомца регистрируются проблемы с концентрацией глюкозы в крови, но печень абсолютно здорова, то, скорее всего, у кошки сахарный диабет.

«Очищение» и «хранение» крови

Избыточное количество медикаментов/гормонов/витаминов, «отходы» метаболизма – все это «оседает» в печени. Но если такой «гадости» накапливается слишком много, то печень начинает погибать, а токсины вновь с кровью разносятся по всему организму, отравляя его. Печень хорошо снабжена кровеносными сосудами. Кровь через этот орган не просто проходит, словно сквозь фильтр, но и задерживается. Поэтому если в результате ранения отмечается сильная кровопотеря, то печень «отдает» свои запасы, чтобы хоть как-то восполнить объем циркулирующей крови.

Защитная функция

Речь не только об очистке крови от токсинов, но и об обеззараживании от бактерий. Печень, «жертвуя» собой, по максимуму задерживает микроорганизмы (клетки способны к фагоцитозу). Поэтому даже если питомец заболевает сальмонеллезом (или иной микроб решит «насолить» усатику), то страдает печень. А ветеринар, заприметив симптомы инфекционного заболевания, а также признаки, характерные для воспаления печени, наверняка скажет вам, что у кошки вирусный гепатит. И это не из-за плохой квалификации специалиста или отсутствия опыта, нет, этот диагноз – общий. Как ОРВИ у нас. Врач же не говорит, какой именно возбудитель привел к воспалению респираторных путей у нас, также можно сказать и про вирусный гепатит у кошек.

Зачем нужна печень? Смотрим на коротком и понятном видео:

Передается ли гепатит от кошки человеку?

Наверняка, этот вопрос интересует многих: можно ли заразиться гепатитом от кошки? Не опасен ли контакт с больным животным?

Если у питомца поставлен диагноз «вирусный гепатит», то человеку не стоит переживать, что он заразиться. Даже в случае, если печень у кота пострадала из-за инфекции, сам гепатит не передается! Максимум чем опасен больной питомец – это тем, что может «поделиться» возбудителем. Куда выше риск, что заразиться другая кошка, нежели человек.

Ни о каком гепатите С речи идти даже не может. Вирусный гепатит у кошки и гепатит С у человека – это абсолютно разные заболевания. Их этиологии отличаются! Поэтому невозможно заразиться гепатитом С от кошки!

Виды гепатита кошек

Существует 2 вида гепатита у кошек — это неинфекционный (токсический) и инфекционный (бактериальный, грибковый, вирусный)

Неинфекционный (токсический)

Токсический гепатит у кошек развивается не только  из-за поступления в организм животного ядов (в том числе и лекарств, особенно, если превышать их дозировку или же неправильно их сочетать). Некоторые препараты способны накапливаться. Печень их задерживает, чтобы защитить организм. Но рано или поздно «плотину» прорвет. И все накопленное попадет в кровоток. В результате – передозировка. И воспаленная, раздраженная и «уставшая» печень уже не сможет быстро и качественно очистить кровь.

Для того, чтобы яд попал в кровь, совершенно необязательно его есть. Токсин может попасть через органы дыхания (например, кошка надышалась парами), через кожу (питомец пробежался по обработанным пестицидами грядкам, могут быть нанесены капли на холку или использована косметика), укусы ядовитых змей/насекомых или же путем инъекции (чаще всего при лечении животного).

Не стоит забывать и про паразитов. Во-первых, они выделяют токсины в процессе своей жизнедеятельности. И если степень инвазии высока, то и яда выделяется очень много. Организм и без того ослабевает, истощается, иммунитет все свои «отправляет» на борьбу с гельминтами. Поэтому печени приходится несладко. А во-вторых, есть и такие паразиты, которые в печени живут, «забивают» желчные ходы, что и приводит к серьезному воспалению.

Инфекционный (бактериальный, грибковый, вирусный гепатит)

Чаще всего инфекционный гепатит у кошек является основным заболеванием. Даже если возбудитель не поражает «целенаправленно» печень, он все равно в нее попадет (с кровотоком). Однако, несмотря на огромную классификацию микроорганизмов, наиболее часто ставит диагноз – вирусный гепатит. Почему так? Да потому что невозможно сказать, какой точно вирус привел к заболеванию. Данный диагноз скорее общий, таким образом, ветеринарный врач дает понять, что у заболевания инфекционная природа.

Причины развития гепатита

Далее поговорим о причинах развития гепатита у кошек гепатита у кошек.

Неинфекционный

Как уже писалось выше, причин развития неинфекционного гепатита у кошки может быть несколько.

  • Токсины поступают через ЖКТ. На первом месте, пожалуй, поступление токсинов через пищеварительный тракт. Например, пища у животного постоянно недоброкачественная (с плесенью или подкисшая). Кот мог съесть и комнатное растение (уж любят они листики и стебельки погрызть), а оно для него ядовито. Мог поймать и мышку, которая была кем-то отравлена крысиным ядом (мышьяком или другими зооцидами). А уж роли самолечения и вовсе стоит отвести отдельную тему. Чем только не пичкают своих питомцев «заботливые» владельцы. То человеческими препаратами, то дозировку превышают (кто-то из-за незнания, кто-то в надежде, что так выздоровление наступит быстрее), то и вовсе запрещенные для котов лекарства дает.
  • Токсины поступают через кожу, легкие. Реже поражают печень токсины, поступающие через кожу или легкие. Только если животное постоянно подвергается воздействию отравляющих веществ. Если кошка один раз вдохнула ядовитые пары, то это еще не значит, что у нее скоро диагностируют гепатит. Вовремя начатая терапия, направленная на детоксикацию, поможет печени быстро восстановиться. Однако если животное частенько вдыхает яды, либо же его кожные покровы постоянно контактируют с опасными веществами, то рано или поздно проблемы с печенью дадут о себе знать.
  • Паразиты. Это и выделение ими токсинов, и механическое повреждение самой печени (в случае, если гельминты паразитируют в ней, прикрепляясь прочно крючками, присосками). Травмированные червями ткани печени становятся более восприимчивыми (открываются ворота для инфекции).

Вирусный

Развивается вирусный гепатит у кошек по причине того, что печень питомца «принимает удар» на себя, как только усатик заболевает. Если вы внимательно читали про функции этого органа, то вы уже знаете, что печень – это «фильтр», барьер, который задерживает патогенные микроорганизмы (путем фагоцитоза). Да, это снижает концентрацию возбудителя в крови, но вот печень сильно страдает. Поэтому практически любое инфекционное заболевание становится причиной развития вирусного гепатита у кошки.

Симптомы

Симптомы гепатита у кошек зачастую настолько явные, что не заметить их практически невозможно.

  1. Наиболее заметный – это желтушность. И слизистые оболочки (во рту, конъюнктива глаз), и сами белки глаз. Чем сильнее поражена печень, тем сильнее желтизна.
  2. Если у кошки инфекционный гепатит, то симптомом будет повышение температуры тела. За лихорадкой обязательно последует вялость, снижение аппетита (вплоть до полного отказа от корма).
  3. Рвота. Нередко с желчью.
  4. Понос (реже запор). Каловые массы практически не окрашены. Цвет фекалий обеспечивается билирубином, который входит в состав желчи. Если функции печени нарушаются (билирубина недостаточно образуется), то кал у кошки серого или серо-желтого цвета (практически бесцветный).
  5. Из-за рвоты и поноса у кошки развивается обезвоживание. И чтобы восполнить запасы жидкости, животное очень жадно пьет.
  6. Раз печень (естественный фильтр) не справляется в полной мере со своей задачей, почкам приходится работать практически на износ. По причине того, что желчные пигменты попадают в кровь (а не с желчью выводятся в двенадцатиперстную кишку), моча становится темной. К тому же в моче при лабораторной диагностике могут обнаружить белок.
  7. Печень увеличивается в размере (при воспалении любой орган становится больше нормы). В норме же этот орган не выступает за последнее ребро (с правой стороны). При гепатите у кошки увеличение печени можно «обнаружить» не только при осторожном ощупывании (пальпации), но и при перкуссии («простукивании»).

Животное выдаст себя, поскольку ему будет больно. Заподозрить проблемы с печенью можно и без перкуссии или пальпации. Стоит взять животное на руки, как оно начнет беспокоиться. Иногда кот шипит, кусается, когда его поднимают, прижимают к себе.

Поставить правильный диагноз поможет биохимический анализ крови. Количество билирубина подскажет, есть ли проблемы с печенью у кошки либо же нет.

Лечение

Как лечить гепатит у кошки? Лечение должно быть исключительно под присмотром ветеринара и соблюдением следующих правил:

  • Без устранения причины, приведшей к заболеванию, лечение кошки, больной гепатитом, будет неэффективным. Если к воспалению привела интоксикация, то необходимо назначить детоксикационную терапию.
  • При необходимости вводить антидоты (например, при отравлении крысиным ядом давать препараты, содержащие витамин К), снижать концентрацию яда в крови (внутривенное введение физиологических растворов).
  • Обязательно поддерживается печень (гепатопротекторов немало, но наиболее распространен эсенциале). Хорошие результаты дает применение витаминов (в частности, из группы В).
  • Животному нужно помогать. Для этого назначаются спазмолитики (такие, как но-шпа, к примеру), которые помогают обезболивать.
  • С антибиотиками нужно быть поосторожнее. Без них не справиться, но и назначать их нужно осторожно (печень и так взбудоражена). В случае, если у кошки подтвержден диагноз вирусный гепатит, потребуется применение иммуностимуляторов и противовирусных препаратов.
  • Если же появились симптомы аллергии, то необходимо назначение антигистаминных препаратов.

Соблюдая все эти правила, вы значительно облегчите лечение кошки от гепатита. Но нельзя забывать о питании, читаем дальше.

Кормление кошки

Чем кормить кошку при гепатите? Диета должна тщательно отслеживаться. Ничего жирного! Первые сутки после постановки диагноза и вовсе придется только на водичке подержать питомца. Затем понемногу вводить кашки (отдавайте предпочтение рису, овсянке). Немножко нежирного фарша можно добавлять лишь через неделю после начала лечения кошки, больной гепатитом (при условии, что животному становится лучше).

Некоторые владельцы интересуется, какими народными средствами можно лечить кошку с гепатитом? Да, положительные результаты дает выпаивание больному усатику отваров ромашки, шиповника, но без устранения причин и применения медикаментов полностью справиться с воспалением не получится. Лекарственные растения могут слегка облегчить состояние, но разве справятся они с возбудителем, если у кошки вирусный гепатит?

Профилактика

Как известно, лучшее лечение — это профилактика. Обязательно делайте прививки кошке от гепатита — не ждите пока питомец заразится. Кроме того следующие правила профилактики этой болезни вам помогут:

  1. Вовремя вакцинируйте свое животное. Это позволит развиться иммунитету и противостоять различным возбудителям. Чем сильнее иммунитет, тем меньше печень участвует в защите организма.
  2. Гоняйте глистов согласно схеме (ежеквартально).
  3. Не кормите сырой рыбой и мясом своего питомца. Это может привести к инфекционному или паразитарному заболеванию (например, к описторхозу).
  4. Не давайте испорченные корма (скисшие, с плесенью).
  5. Не кормите жирным.
  6. Не занимайтесь самолечением. Либо же соблюдайте прописанную ветеринаром дозировку и кратность введения препаратов.
  7. Не держите питомца в плохо проветриваемых помещениях (особенно, если дома ремонт). Все потенциальные яды (бытовую химию, лакокрасочные изделия, топливо, растворители, пестициды, гербициды и прочее) держите в недоступном для питомца месте.
  8. Если обрабатываете от усатика от накожных паразитов либо же моете, то будьте осторожными. Не превышайте дозировку препарата. А косметические средства тщательно смывайте.
  9. Не позволяйте своему котику контактировать с бездомными либо же подозрительными животными. Такое общение потенциально опасно (существует риск заражения инфекционными или паразитарными заболеваниями).

Надеемся статья вам помогла! Если остались вопросы по гепатиту у кошек — пишите в комментариях!


Хронические заболевания печени у мелких животных

Введение

Печень – важный орган, ответственный за расщепление питательных веществ и синтез многих молекул, таких как альбумин, факторы свертывания крови, холестерин, глюкоза и многие другие. Печень обладает феноменальной способностью к регенерации. Например, у людей половину печени можно пересадить от живого донора реципиенту, и через 6 недель как пересаженная печень, так и остаток печени донора достигнут нормального объема. Несмотря на способность печени к регенерации, заболевания печени могут привести к смерти, так как организм не может жить без печени, а экзогенная поддержка функции печени у собак и кошек в настоящее время невозможна, даже в течение короткого периода времени. Заболевания печени часто встречаются у собак и кошек. Острое поражение печени может быть вызвано инфекционными болезнями или интоксикациями. Хронические заболевания печени встречаются чаще, чем острые поражения. Наиболее распространенными хроническими заболеваниями печени являются хронический гепатит или холангит, гепатопатии, ассоциированные с накоплением меди, ятрогенные заболевания печени и сосудистые поражения печени, которые, за исключением сосудистых поражений печени, будут более подробно рассмотрены ниже. 

Хронический гепатит и холангит

Хронический гепатит – это гетерогенная группа хронических заболеваний печени у собак, которая ассоциирована с воспалительной инфильтрацией печени. Сходным образом, холангит – это гетерогенная группа заболеваний печени и желчных протоков у кошек, которые также приводят к воспалительной инфильтрации печени и желчных протоков. Существует много различных этиологий хронического гепатита/холангита, включая инфекции (например, инфекционный гепатит собак или лептоспироз), влияние лекарств (например, противосудорожных препаратов), наследственную предрасположенность (например, у доберман-пинчеров, бедлингтон-терьеров, кокер-спаниелей, вестхайдлендских белых терьеров и др.). Однако большинство случаев хронического гепатита/холангита являются идиопатическими. 

Клиническая картина

Клинические признаки у собак и кошек с хроническим гепатитом/холангитом часто являются неспецифическими. Наиболее частыми являются сонливость, анорексия, снижение массы тела и рвота. У кошек с холангитом также могут обнаруживаться повышенная температура тела и боли в животе. При недостаточности функции печени возможны и другие признаки, такие как диарея, полидипсия, полиурия, желтуха, асцит и геморрагический диатез. 

Наиболее частым результатом обследования у собак и кошек с хроническим гепатитом/холангитом является повышение уровней ферментов печени, таких как аланин-аминотрасфераза (ALT) и сывороточная щелочная фосфатаза (SAP). В более тяжелых случаях могут также наблюдаться гипоальбуминемия, гипербилирубинемия, гипохолестеринемия и снижение уровня азота мочевины крови (BUN). Примерно у половины всех кошек с холангитом имеется гиперглобулинемия, но она не является частым признаком у собак с хроническим гепатитом.

Концентрации желчных кислот  натощак и после еды могут быть повышенными в зависимости от тяжести патологического процесса.

У пациентов с печеночной недостаточностью параметры свертывания крови могут быть аномальными, либо из-за нарушения синтеза факторов свертывания крови, либо из-за диссеминированной внутрисосудистой коагуляции. 

Рентгеновские снимки брюшной полости обычно в пределах нормы. Однако у пациентов с последней стадией цирроза печень может выглядеть уменьшенной. 

Ультразвуковое исследование органов брюшной полости часто выявляет изменения

эхогенности печени и неровные края печени. В более тяжелых случаях могут визуализироваться асцит и приобретенные внутрипеченочные шунты. 

Диагностика

Диагностика хронического гепатита/холангита основана на гистопатологии. Цитологической оценки тонкоигольного аспирата недостаточно для постановки диагноза хронического гепатита/холангита. Биоптаты для гистопатологической оценки можно получить посредством биопсии режущей иглой, лапароскопии или диагностической лапаротомии.

Биопсия режущей иглой менее инвазивна, но пригодна лишь для получения небольших биоптатов. В противоположность этому, лапароскопия обеспечивает получение образцов значительно большего размера, а также возможность визуальной инспекции поверхности печени и прямого выявления кровотечения.

В одном из исследований было высказано мнение, что биопсия при лапароскопии превосходит биопсию режущей иглой. Однако для того, чтобы сделать окончательную оценку, необходимо большее число исследований.

Независимо от способа, которым выполнена биопсия, один из биоптатов следует обязательно направить на бактериологическое культивирование. 

Лечение

Лечение хронического гепатита/холангита может быть направлено на основную причину заболевания, то есть на воспаление печени, или может быть поддерживающим или симптоматическим по своей природе у пациентов с печеночной недостаточностью. 

Терапевтические меры, направленные на основную причину, могут представлять собой антибиотикотерапию у собак с лептоспирозом или у кошек с гнойным холангитом. В других случаях они могут представлять собой изменение противосудорожного  препарата у собак с хроническим гепатитом, обусловленным противосудорожным лечением. У пациентов, у которых исключена инфекционная этиология, может быть начата противовоспалительная терапия.

Не существует контролированных исследований, в которых оценивалась бы польза от терапии кортикостероидами для собак с хроническим гепатитом. Однако большое ретроспективное исследование выявило полезный эффект от лечения кортикостероидами у собак с хроническим гепатитом. Автор предпочитает использовать кортикостероиды в тех случаях, когда бактериальная культура из биоптата печени отрицательна и пациент не реагирует на попытки эмпирического лечения антибиотиками. Если используются кортикостероиды, то начать лечение пациента следует с высокой дозы преднизона или преднизолона, равной 2 мг/кг два раза в день в течение 5 дней, затем 1 мг/кг два раза в день в течение 6 недель, после чего дозу следует медленно свести на нет. Если побочные эффекты кортикостероидов становятся очень сильными, можно рассмотреть возможность использования других противовоспалительных агентов, таких как азатиоприн.

За пациентами, получающими лечение противовоспалительными средствами, следует внимательно наблюдать, поскольку некоторые пациенты могут не получить пользы от кортикостероидов, и их состояние может даже ухудшиться. 

Поддерживающая терапия может включать в себя применение урсодезоксихолевой кислоты, S–аденозил–L–метионина (SAME) или других антиоксидантов. Хотя  контролированных исследований, выполненных на собаках и кошках, нет, испытания на людях показали полезный эффект урсодезоксихолевой кислоты у пациентов с хроническим гепатитом. Недавно было предложено использовать антиоксидант S–аденозил–L–метионин (SAME) для вспомогательной терапии у собак и кошек с хроническим гепатитом/холангитом. Начальные исследования показали, что SAME пополняет запас глутатиона, однако данных, полученных на пациентах в клиниках, еще недостаточно. Некоторыми авторами предлагались другие агенты, например – витамин Е, силимарин или экстракт расторопши пятнистой, но имеется мало данных относительно их эффективности. Считается, что некоторые агенты обладают антифибротическими свойствами, в том числе колхицин, преднизолон, азатиоприн и другие. К сожалению, не продемонстрирована эффективность ни одного из этих агентов у собак и кошек с хроническим гепатитом/холангитом. 

Пациентов с печеночной недостаточностью следует кормить кормами с низким содержанием белка. Кроме того, для лечения гепатической энцефалопатии можно использовать оральное введение лактулозы и неомицина.

Гепатопатии, ассоциированные с накоплением меди

Медный токсикоз (CT) характеризуется чрезмерным накоплением меди в гепатоцитах и представляет собой наследственное заболевание печени, которое встречается главным образом у бедлингтон-терьеров, а также у вестхайлендских белых терьеров, скай-терьеров, доберман-пинчеров, а недавно было обнаружено у лабрадоров-ретриверов. Сходное заболевание очень редко встречается у сиамских кошек. 

Наследственные предпосылки 

Показано, что у бедлингтон-терьеров медный токсикоз наследуется по аутосомно-рецессивному типу. Исследования сцеплений выявили сцепление медного токсикоза с маркером СО4107. В настоящее время имеется генетический тест на медный токсикоз для бедлингтон-терьеров (www.vetgen.com). Этот тест можно использовать для выявления собак, предрасположенных к этому заболеванию, которые получат пользу от лечения, препятствующего накоплению меди, с целью предотвращения развития клинической картины заболевания. Тест также является научным инструментом, который поможет заводчикам собак разработать стратегию разведения.

Патофизиология 

Медный токсикоз у бедлингтон-терьеров сходен с болезнью Вильсона у людей. Медь в норме хранится в гепатоцитах. У собак с медным токсикозом содержание меди в печени увеличивается до тех пор, пока не будет превышен критический пороговый уровень. Возникает повреждение тканей, степень которого зависит от содержания меди в печени и варьирует от острого некроза печени до цирроза печени. Собаки с медным токсикозом могут также переносить тяжелый гемолитический криз после стрессовых событий, таких как роды. Избыток меди, накопившийся в печени, может быть выделен в кровоток, что приводит к гемолитической анемии, острой почечной недостаточности и диссеминированному внутрисосудистому свертыванию крови (DIC).

Клинические признаки

Частыми клиническими признаками являются анорексия, рвота и диарея. У хронически больных собак могут также развиться желтуха, асцит и гепатическая энцефалопатия. У любой собаки с медным токсикозом может развиться связанный со стрессом острый гемолитический криз.

Диагностика

Для диагностики необходимо исследование биоптатов печени, окрашенных специальным красителем для выявления меди. Измерение концентрации меди в печени предпочтительно, и содержание меди, превышающее 850 мкг/г сухой массы, считается признаком нарушения накопления меди.

Лечение

У собак с медным токсикозом нарушены хранение и выделение меди. Поэтому основной терапевтический подход состоит в том, чтобы предотвратить избыточное накопление меди. Для обеспечения низкого потребления меди необходимо исключить из рациона такие источники белка, как ракообразные, печень, почки и сердце. Многие коммерческие корма для животных также имеют высокое содержание меди, и поэтому следует тщательно исследовать корма, прежде чем кормить ими животное в течение длительного времени.

Цинк обладает способностью блокировать всасывание меди в кишечнике, и поэтому его можно использовать в качестве пищевой добавки (100 мг цинка перорально два раза в день в течение 3 месяцев, затем по 50 мг перорально два раза в день) на фоне диеты с низким содержанием меди. Раннее изменение рациона у собак, имеющих генетический дефект, связанный с медным токсикозом, может предотвратить или отсрочить появление клинических признаков.

Однако, если болезнь, связанная с нарушением накопления меди, уже развилась, следует назначить агенты, образующие комплексные соединения с медью, например – D-пеницилламин (10-15 мг/кг перорально два раза в день), чтобы попытаться снизить содержание меди в печени.

Противосудорожные препараты

Противосудорожные препараты, по-видимому, являются наиболее частой причиной ятрогенного заболевания печени у собак, но редкой причиной – у кошек, поскольку кошек переводят на противосудорожную терапию значительно реже, чем собак. Фенобарбитал, примидон или фенитоин могут вызвать хроническое заболевание печени.

Клинические признаки у собак с заболеванием печени, вызванным противосудорожными препаратами, сходны с клиническими признаками у собак с другими хроническими заболеваниями печени, например – анорексия, сонливость, снижение массы тела, желтуха, асцит и геморрагический диатез. Кроме того, у собак могут наблюдаться атаксия, седативный эффект и снижение частоты судорожных припадков.

Диагноз заболевания печени, вызванного противосудорожными препаратами, можно заподозрить у пациентов с приемом противосудорожных препаратов в анамнезе и с клиническими признаками заболевания печени и/или с повышенной активностью ферментов печени в сыворотке. Следует отметить, что противосудорожное лечение фенобарбиталом, примидоном и фенитоином повышает активность ферментов печени, но не вызывает повышения активности ферментов печени в сыворотке, которое свидетельствует о поражении печени. Тем не менее, резкое возрастание активности ферментов печени, клинические признаки заболевания печени и маркеры заболевания печени, такие как концентрация желчных кислот в сыворотке или концентрация альбумина в сыворотке, могут быть полезными для постановки диагноза. Также полезным является ультразвуковое исследование брюшной полости с целью выявления изменений в паренхиме печени.

Лечение заболевания печени, вызванного противосудорожными препаратами, включает в себя перевод пациента на другой противосудорожный препарат, например – на бромид калия, и, возможно, поддерживающую и симптоматическую терапию, описанную выше.

Диазепам 

Диазепам использовали как стимулятор аппетита у кошек. Однако у некоторых кошек развился смертельный некроз печени. Если у кошек, получающих лечение диазепамом, появляются клинические или биохимические признаки поражения печени, то лечение необходимо немедленно прекратить и при необходимости начать поддерживающую или симптоматическую терапию.

Карпрофен

Карпрофен – это нестероидное противовоспалительное средство, используемое для лечения хронического артрита у собак. Карпрофен ассоциирован с идиосинкратическим поражением печени к собак. Сообщалось, что повышен риск для лабрадоров-ретриверов.

Лечение включает в себя прекращение приема карпрофена и, при необходимости, поддерживающую и симптоматическую терапию.

Многие другие лекарственные препараты могут вызывать поражение печени. Однако в большинстве случаев эти поражения считают идиосинкратическими реакциями, развиваются они остро, и предсказать их невозможно.

Гепатит у кошек — словарь ветеринарных терминов — ВЦ Зоовет

Гепатит — воспаление печени диффузного характера, сопровождающееся гиперемией, клеточной инфильтрацией, дистрофией, некрозом гепатоцитов и других структурных элементов, резко выраженной печеночной недостаточностью. Патологический процесс бывает острым и хроническим, первичным и вторичным. У кошек чаще всего регистрируется острый паренхиматозный гепатит.

Это заболевание возникает на почве инфекционных или инвазионных болезней, гастритов, энтероколитов, отравлений различными ядами, из-за длительного применения лекарственных препаратов (экстракта мужского папоротника, препаратов фосфора), токсикозов беременности, ожогов тела и радиационных поражений.
Гепатит в основном возникает после какой-либо инфекционной или инвазионной болезни, поэтому его симптоматика складывается из признаков основной болезни. Животное угнетено, аппетит понижен, наблюдаются жажда, рвота, повышение температуры тела, учащение дыхания, выделения из носовых ходов с примесью крови, слизистые становятся желтушного оттенка, моча — темного цвета.
Диагноз ставит ветеринар на основании осмотра животного, результатов клинического анализа крови (исследования уровня содержания билирубина).

Животному назначается диетическое питание, из рациона исключают жирную пищу и сахар. В начале лечения проводят голодную диету в течение 24 часов со свободным доступом к воде или регидрационным растворам. В миску для питья можно налить и минеральную воду. К жидкостям желательно добавлять отвары и настои трав — корня алтея, череды, листьев тысячелистника, шалфея и других растений, оказывающих лечебное воздействие на печень и органы пищеварения. Кроме воды, кошкам полезно давать мясные и рыбные бульоны. На 2-4-й день лечения в рацион вводят небольшими частыми порциями рисовую, геркулесовую или манную каши, рисовый отвар. В кашу добавляют небольшое количество отварного куриного или говяжьего фарша (1-2 столовые ложки на прием). Если в дальнейшем не наблюдается расстройства пищеварения в виде рвоты и поноса, дозу корма постепенно увеличивают. На 3-5-й день в пищу можно вводить свежие, теплые, в небольшом количестве, нежирные молочные продукты, а с 6-9-ого дня — вареные мелко измельченные овощи — морковь, капусту, картофель. Начиная с 10-го дня можно давать обычный рацион при условии успешного лечения. Если вы кормите свою кошку готовыми промышленными кормами, из диетических подойдут корма для лечения желудочно-кишечных расстройств и болезней печени. Сначала дают консервы, постепенно переходят на гранулы сухого корма.
Для нормализации функционирования печени и кишечника в пищу ежедневно вводят глюкозу, инсулин, липокаин, кокарбоксилазу, рибофлавин, викасол и т. д. При осложненных формах гепатита врач может назначить кортикостероидные препараты. Для ускорения выведения токсичных продуктов из кишечника назначаются слабительные средства, а для предотвращения развития микробов — антибиотики, сульфаниламиды.

Для профилактики гепатита необходимо исключить скармливание кошкам токсичных, испорченных продуктов, сбалансировать рацион по всем питательным веществам, избегать необоснованного применения лекарственных средств, оказывающих токсическое действие на печень.

Гепатит у кошки: симптомы, терапия, прогноз

Пушистые друзья подвержены заболеванию гепатитом чаще, чем люди. У них он представляет собой заболевание печени. Бывает хронический и острый гепатит у кошек. Болезнь часто развивается на фоне гастрита, различного рода отравлений, токсикозов во время беременности и многих инфекционных заболеваний.

Первые признаки болезни

Последствия гастроэнтерита, длительного лечения препаратами, отравления ядами для вредителей или некачественными продуктами могут вызвать распад клеток печени. Первым звонком для хозяина должно стать изменение цвета слизистых. Гепатит печени у кошек характеризуется тем, что язык и ротовая полость приобретают желтушный оттенок. Обычно ласковое животное может проявлять беспокойство, когда его гладят, в особенности когда задевают место, где находится печень.

Рвота, диарея, резкое снижение веса могут дополнять картину заболевания. Питомца необходимо немедленно показать врачу. Не стоит самостоятельно лечить болезнь. Правильно назначенное лечение поможет избежать негативных последствий. Гепатит у кошки — еще не приговор. В ветеринарной клинике обязательно сделают анализы, на их основании поставят диагноз и назначат соответствующее лечение.

Почему печень — важный орган?

  1. Печень — связующее звено между пищеварительной и кровеносной системами.
  2. Она образует желчь для расщепления пищи.
  3. Печень регулирует обмен веществ. Образует вещества для работы всех органов. Следит за гормональным фоном.
  4. Нормализует уровень глюкозы.
  5. Занимается очищением крови от ядов и вредных веществ.
  6. Спасает организм от инфекций, жертвуя своими клетками.

Инфекционный гепатит у кошки

Этот вид заболевания наиболее часто поражает печень. Гепатит может являться самостоятельным заболеванием. В любом случае, попадая в организм кошки, вирусы или микробы наносят удар по печени, поскольку этот орган со своей очистительной функцией принимает на себя главную угрозу. Особенно часто подвержены вирусному гепатиту животные, свободно гуляющие по улице. Поймать микробы они могут от общения с другими котами и кошками или просто съев недоброкачественную пищу.

Неинфекционный гепатит: причины возникновения

Причины этого заболевания более разнообразны. Одним из видов неинфекционного является токсический гепатит у кошек. Яды и токсины, попадающие в организм животного, вызывают эту форму болезни.

Пищевое отравление наиболее часто является главной причиной заболевания. Привычка котов не доедать всю порцию сразу может привести к тому, что еда в чашке подкиснет и вызовет отравление. Коты-мышеловы могут поймать крысу, отравленную ядом. В некоторых случаях достаточно даже малейшего контакта с вредителем, чтобы получить сильнейшее отравление мышьяком. Любовь питомцев к комнатным растениям может обернуться большой бедой. Животное запросто может получить отравление, съев ядовитый листик. Хозяевам нужно быть осторожными, заводя в доме растения, способные навредить пушистым любимцам. Некоторые владельцы котов пытаются лечить самостоятельно легкие заболевания. При этом не соблюдают дозировки или просто дают животным препараты, предназначенные для человека. Такая любовь может принести гораздо больше вреда, чем пользы. Нужно помнить, что организм питомца сильно отличается от человеческого. И то, что помогает хозяину, кошку может убить.

Другие причины возникновения неинфекционного гепатита

Получить отравление животное может и вдыхая ядовитые пары. Начиная ремонт в доме или занимаясь травлей насекомых, необходимо изолировать питомца. Хотя, вдохнув испарения краски, кот не сляжет с гепатитом, но и ничего хорошего от этого не случится.

Почему возникает гепатит у кошки? Паразиты часто являются причиной неинфекционного типа заболевания. Они разрушают клетки печени, влияя на нее с помощью выделяемых продуктов жизнедеятельности. К тому же поврежденный орган становится более восприимчивым к другим инфекциям и вирусам.

Гепатит у кошек: симптомы и лечение

Как проявляется у кошек гепатит? Симптомы его следующие:

  1. Желтые белки глаз и слизистые оболочки ротовой полости.
  2. Повышается температура тела при вирусной форме. В связи с этим животное может стать вялым, потерять аппетит.
  3. Выделение желчи при рвоте.
  4. Диарея. Цвет каловых масс почти бесцветный либо серый.
  5. Обезвоживание вследствие диареи. Кошка часто просит воды и пьет жадно.
  6. Отказ полноценной работы печени сказывается на почках. Моча может стать темной из-за желчных пигментов. Лабораторный анализ покажет белок в ней.
  7. Болезненный комок в области печени. Орган увеличен и вызывает болезненные ощущения. Животное не дается на руки, шипит и кусается.
  8. Биохимический анализ крови показывает ненормальное содержание билирубина.

Как проводится лечение гепатита у кошек? Выбор варианта терапии зависит от формы заболевания. Вначале необходимо устранить причину, повлиявшую на работу печени.

  1. Если это произошло от отравления, то необходима детоксикация. Возможно введение антидотов. Часто требуется внутривенное введение физиологического раствора. При первых признаках отравления владелец животного может дать небольшую дозу адсорбента (например, активированный уголь).
  2. Витамины группы В и гепатопротекторы помогут восстановлению функции пораженной печени.
  3. Для снижения болевых ощущений в острой фазе развития болезни назначают спазмолитические и обезболивающие средства. Возможно применение «Дротаверина» в небольших дозах. Рассчитать количество лекарства может врач, учитывая показания к приему препарата, вес и состояние животного.
  4. При вирусном гепатите применяются антибиотики. Назначение их требует осторожности. Пораженная печень с трудом может справиться с дополнительным лечением. Но уничтожить вирус способны только определенные лекарственные препараты. Для поддержания здоровья и сил питомца применяют иммуномодуляторы.
  5. Сложный комплекс препаратов способен вызвать аллергическую реакцию организма. В этом случае назначают антигистаминные средства.
  6. Возможно применение народных методов лечения как дополнительных. Но без устранения причины никакие домашние средства не способны справиться с болезнью. Поддержать организм помогут отвары ромашки и шиповника. Их применяют в качестве витаминных добавок и антисептиков.
  7. Врач обязательно назначит диетическое питание. Соблюдать режим надо неукоснительно. Правильная пища поможет снизить нагрузку на больной орган и облегчить состояние питомца. В первые дни, скорее всего, придется ограничить питание кота одной водичкой. Далее необходимо перевести любимца на кашки. Рис, гречка, овсянка станут основными блюдами в меню. Отварные мясные нежирные продукты можно давать не ранее, чем через неделю после начала лечения. Постоянная консультация с ветеринаром поможет точно определить, пора ли вносить изменения в корм животного.

Профилактика заболевания

Всегда проще предотвратить болезнь, чем лечить ее. Внимательное отношение к здоровью животного поможет понизить риск возникновения гепатита.

  1. Не стоит пренебрегать вакцинированием кошки. Вовремя проставленные прививки помогут повысить иммунитет и ослабят нагрузку на печень.
  2. Ежеквартальная протравка питомца от глистов согласно инструкции избавит печень от нагрузки.
  3. Описторхоз поджидает кошку в необработанных сырых продуктах. Возможность заразиться очень велика, если постоянно давать кошке сырое мясо или рыбу.
  4. Пища должна быть только свежей. Не надо накладывать в чашку порции с запасом, если приходится уходить на весь день. Закисший корм, особенно в летнее время, может навредить больше, чем если животное немного проголодается до возвращения хозяев.
  5. Не стоит давать жирную пищу, особенно если время от времени появляются проблемы с пищеварительной системой.
  6. Лечение животного без установления диагноза и назначения правильной дозировки способно нанести огромный вред не только печени, но и другим органам. Любой препарат необходимо давать питомцу только после консультации с ветеринаром.
  7. Оградить кошку от нечаянного употребления ядов. Удобрения, лекарства и бытовую химию хранить в закрытых шкафах, чтобы любопытный питомец случайно не разорвал упаковку и не попробовал интересный порошок на вкус. Заводя в доме комнатные растения, стоит поинтересоваться на предмет ядовитости их для животного. Пережить без красивого цветка можно, а вот спасать животное, отравившееся им, будет сложно.
  8. Мыть животное от блох или обрабатывать шкуру препаратами нужно с осторожностью. Кошка обязательно помоет мокрую шкурку языком. Остатки средства могут попасть в организм животного и вызвать отравление.
  9. Выпускать без присмотра животное на улицу нельзя. Бездомные представители кошачьего семейства — отличные переносчики микробов и вирусов. Если получилось, что питомец все-таки решил погулять без хозяйского глаза, то стоит присмотреться к его состоянию после прогулки и при малейших признаках заболевания обратиться в клинику.

Передается ли людям

А правда ли, что гепатит у кошки передается человеку? Нет. Это заболевание не опасно для людей. Этиология человеческого гепатита С не имеет ничего общего с заболеваниями печени животного.

Даже при самой высокой стадии разложения печени питомца хозяину гепатит не грозит. Хотя риск получения в подарок инфекции все-таки есть.

Прогноз зависит от многих факторов

Насколько долго проживет хвостатый любимец, зависит от того, как рано хозяин обратит внимание на его состояние. К сожалению, без должного лечения и строгого соблюдения диеты жизнь животного может окончиться довольно быстро.

Заключение

Теперь вы знаете, как проявляется гепатит у кошек, симптомы этого заболевания мы описали. Также затронули тему профилактики такой болезни и ее лечения.

Гепатит у кошек — симптомы и лечение

Этот медицинский диагноз описывает воспалительные процессы, которые происходят в тканях печени. Поскольку у кошек гепатит проявляется неспецифичными симптомами, то и выявить недуг вовремя не всегда удается. Итак, узнаем об особенностях этой болезни у домашних питомцев и ее терапии.

Виды гепатита

Существует немало факторов, которые приводят к воспалению тканей печени. В зависимости от них различают токсический и инфекционный гепатит у котов. Последний развивается как осложнение грибковых, вирусных, бактериальных инфекций, например, энтерита и лептоспироза. В группе риска развития инфекционного гепатита — пожилые кошки и невакцинированные молодые. Когда животному, к примеру, сделана прививка от чумки, но оно все-таки заболело, тогда риск возникновения инфекционного гепатита очень низкий. Привитые животные гораздо легче переносят недуг, скорее поправляются.

Токсический вид заболевания в большинстве случаев бывает результатом отравления химикатами, ядами, лекарствами, некачественным кормом. Все попадающие в организм токсины проходят через печень, и ее клетки очищают кровь от вредных компонентов. Заметим, что при кратковременном воздействии ядов и своевременной реакции хозяина токсический гепатит у кошек успешно лечится. Если же яды месяцами проникали в организм домашнего питомца, незаметно и постоянно разрушали клетки печени, то в полной мере восстановить работу органа не получится.

Стоит упомянуть и о таком виде опасности для печени, как гельминты. Они разрушают целостность органа и отравляют его продуктами своей жизнедеятельности. В таких ситуациях лечение гепатита сводится к борьбе с глистами. Но поскольку антипаразитарные препараты негативно действуют, прежде всего, на печень, то есть риск спровоцировать токсический гепатит. Если же в печени паразитов много, то мертвые будут раскладываться и еще больше отравлять орган. Кошка в этом случае может умереть от интоксикации.

Что касается вирусного гепатита, то, в отличие от собак, у кошек он не выявлен.

О признаках гепатита

Для всех видов заболевания существуют общие симптомы. Это изменение окраса слизистых оболочек и конъюнктивы глаз на желтый цвет; потеря аппетита; повышение температуры тела; позывы к рвоте; диарея, переходящая в запор. Кота мучит сильная жажда, и он часто пьет, при этом жадно глотает воду. Кал питомца становится серо-желтым или светлым. Моча животного приобретает темный цвет из-за присутствующих в ней белка, билирубина, желчных пигментов. Животное резко теряет вес. Как видим, признаки недуга схожи с болезнями системы пищеварения.

Если печень кота пальпировать, то это ему доставит боль и сильный дискомфорт. Орган увеличивается.

Внимательный хозяин всегда замечает изменения в поведении кошки, ее внешнем виде. Если же он пропустит вышеуказанные признаки, то острая форма гепатита просто перетечет в хроническую.

О лечении кошачьего гепатита

Терапия этого заболевания у животных базируется на устранении причин, которые его вызвали. Основой лечения является соблюдение диеты. Она кошке рекомендуется с первого дня после выявления недуга. Сначала ветеринары советуют день-два кошку не кормить, а только отпаивать минеральной водой. При отказе от питья надо вливать жидкость в пасть пипеткой или шприцом без иглы. После такой очистки в рацион кота вводят каши. Но без масла! Лучше сварить животному овсянку или манку. С кашами можно чередовать нежирные бульоны, легкие супы. Питье кошки, больной гепатитом, — это отвар шиповника и ромашки. Они восстанавливают работу желудка и печени. Только через неделю в рацион больного животного разрешается вводить отварное мясо и нежирные молочные продукты.

С десятого дня можно насытить рацион питомца овощами, кашами с маслом, рыбой и другими привычными продуктами в небольшом количестве.

Что касается лекарственной терапии, то она направлена на восстановление здоровой работы печени. Ветеринары с этой целью назначают витамин В, антибактериальные препараты, спазмолитики. Кошкам раствор глюкозы с витамином С вливается внутривенно. Это уничтожает токсичные вещества и препятствует обезвоживанию организма заболевшего.

Внимательный хозяин кота при первых признаках неблагополучия обязан сразу же обратиться к ветеринарному специалисту. Только так можно полностью вылечить гепатит.

Гепатит у кошек: симптомы, лечение

Данная болезнь представляет собой воспалительный процесс в паренхиме печени. Сопровождается обширным кровоизлиянием и приводит к ее дистрофии, распаду клеток и острой недостаточности. Гепатит у кошек сложно диагностировать, вследствие сходных симптомов с другими заболеваниями.

Главное в лечении – определить причину возникновения. Основными факторами являются воздействие на печень животного токсических и аллергических веществ, проникновение инфекции в организм, наличие гельминтов.

Виды гепатита

  • Инфекционный (вирусный) гепатит. Возникает в качестве осложнения перенесенных грибковых, вирусных или бактериальных заболеваний. Больший риск имеют не привитые кошки. Животные после прививки гораздо легче переносят любую инфекцию.
  • Токсический гепатит. Появляется в результате действия на печень ядовитых веществ, химикатов. Может быть последствием отравления лекарственными средствами, испорченным просроченным кормом и другими продуктами. Все токсины поступают в кровь, накапливаются и оседают в печени, которая фильтрует и очищает организм от ядов. Длительный прием токсинов разрушает печень и не дает возможность полного исцеления.

Гепатит проходит в острой или хронической формах. Острая – длится на протяжении двух-трех дней, а хроническая – на протяжении нескольких месяцев.

Симптомы гепатита

Существуют общие симптомы, характерные для всех видов гепатита:

  • слизистые оболочки и конъюнктивы глаз окрашены в лимонный или яркий желтый цвет;
  • температура тела гораздо выше нормы;
  • утрата чувства голода;
  • сильная жажда, заболевший кот часто просит пить, глотает воду с особым шумом и жадностью;
  • позывы к рвоте;
  • понос, переходящий в запор или наоборот;
  • выходящий кал имеет серо-желтый или светло-желтоватый цвет;
  • присутствие билирубина, белка и желчных пигментов в моче придают ей темное окрашивание;
  • видимое резкое снижение веса.

В моменты прощупывания в районе печени наблюдается заметное беспокойство животного. Это говорит о болезненном состоянии и неприятных ощущениях.

Аллергическому гепатиту помимо таких признаков сопутствуют еще шелушение, зуд покровов, крапивница. В некоторых случаях лопаются и кровоточат определенные пораженные участки кожи.

Под воздействием болезнетворных микроорганизмов нередко острый вирусный гепатит прогрессирует и перетекает в хроническую форму. Опасность заключается в собирании жидкости в брюшной полости (асцит) и развивается геморрагический диатез. Запомните, гепатит у кошек не передается человеку и заразиться им не возможно.

Лечение гепатита

Лечение строится на устранении причин, диетическом питании и приеме специальных медикаментов.

  1. С первого дня, после выявления диагноза, рекомендуется строжайшая диета. С самого начала кота нельзя кормить, только давать большое количество минеральной воды. При отказе животного насильно пипеткой вливать жидкость.
  2. Через пару дней, в рацион ввести легкие каши, без масла. Лучше всего подойдет овсянка, рис, геркулес, манка. Нежирный бульон или суп можно чередовать с кашами. Обязательно в перерывах между едой давать отвары и настои из шиповника, ромашки, череды, тысячелистника, восстанавливающих работу желудка, кишечника, печени.
  3. Спустя неделю добавлять отварное мясо, овощи, молочные продукты.
  4. С десятого дня, с наступлением улучшения состояния питомца, разрешается возвращаться к обычному, привычному для котенка питанию.

Лекарственная терапия направлена на восстановление функционирования печени. При гепатите назначаются антибиотики, витамин В, спазмолитики. Внутривенно вливается раствор глюкозы с витамином С, которые предупреждают обезвоживание и уничтожают токсичные вещества. Дополнительно принимаются антигистаминные средства, во избежание аллергических проявлений.

Самолечение категорически не приветствуется. Внимательный хозяин домашнего любимца с первыми симптомами сразу же должен обратиться к ветеринару, который окажет необходимую помощь и проведет квалифицированное лечение болезни.

Поделиться этой статьёй

Рубрики: Болезни кошек |

автор admin

Токсический гепатит у кошки: ru_cats — LiveJournal

Заранее прошу прощения за сумбур и панику — двое суток почти не спала и почти не ела — вчера с утра кошке стало плохо, и это были самые ужасные два дня…

Кошке десять лет, беспородная. 20 мая была операция по стерилизации, перед ней сделаны все анализы — биохимия крови, рентген, УЗИ органов малого таза — все в порядке, более того, было сказано что «для вашего возраста все показатели очень и очень хорошие». После операции по рекомендации врача была переведена с сухого Хиллса i/d на Хиллс для стерилизованных кошек старше семи лет. Поначалу ела с охотой, но через какое-то время стала есть неохотно и мало, а затем и вовсе отказываться от корма, похудела. Попробовала предложить вместо сухого влажный Хиллс в пакетиках — снова сперва стала есть с удовольствием, а через некоторое время опять неохотно. Позавчера весь день почти не ела, но поведение не никак не менялось, ласкалась, играла с другой кошкой. Вчера с утра была вялая, два раза ее стошнило пеной, и мы повезли ее в ту же самую клинику. Там ей сделали рентген, УЗИ, ничего не нашли, взяли анализ крови(был готов на следующий день), померяли температуру — 35 при норме 38; кошка к тому времени стала еще более вялая, предположительный диагноз был сосудистая реакция — поставили капельницу (мексидол 1,0мл, цитофлавин 1,0мл, контрикал 2 тыс.ед, рибоксин 1,0мл, рингера 30,0мл) и фуросемид 0,4мл в/м после капельницы. Почти сразу после капельницы кошка свесилась тряпочкой и задышала часто и тяжело — ее на несколько часов положили в бокс с кислородом. Подозревали сосуды/сердце/легкие/онкологию, но сказали — до результатов анализа крови просто ждем.

К утру ей немного полегчало, температура повысилась до 37,5, в обед сегодня снова поставили такую же капельницу, после которой кошь снова легла тряпочкой (врач сказал, что лекарства успокаивают/расслабляют). Вечером пришли результаты биохимии крови, по которой врач определил токсический гепатит и как следствие анемию. К сожалению, анализы остались в клинике и я в полубессознательном состоянии не догадалась их скопировать. Был очень завышен билирубин — 1,96 при норме, кажется, 0,4. Некоторые другие показатели тоже были завышены, но не так критично, и как следствие завышенного билирубина. Что-то было понижено(анемия). Врач сказал, что странно, что ничего не было видно на рентгене(УЗИ?) и что при таком завышенном уровне кошь не пожелтела, но такое бывает. Я спросила, не нужны ли какие-нибудь еще анализы, цитология печени — врач сказал, что нет. Назначил капельницу — ежедневно с завтрашнего утра — помимо уже выписанного(мексидол 1,0мл, цитофлавин 1,0мл, контрикал 2 тыс.ед, рибоксин 1,0мл, рингера 20,0мл) гептрал 0,5, реамберин 10,0, внутримышечно помимо фуросемида 0,4мл — преднизолон 0,4мл и гептрал 0,5мл. Внутрь энтеросгель и отвар ромашки.
Кошь сейчас дома (два дня провела в стационаре в клинике), сходила в туалет, попила, даже немного поела, но вялая и периодически лежит тряпочкой, практически не реагируя ни на что.
Сейчас читаю в сети про токсический гепатит, понимаю в теперешнем полубессознательном состоянии мало, но истеричные вопросы уже появились — правильно ли поставлен диагноз, не нужны ли какие-нибудь дополнительные анализы(исключить гепатоз, холецистит, инфекционный перитонит/FIP?)? Верное ли лечение, не нужно ли чего-нибудь дополнительно? Из-за чего это могло возникнуть так внезапно? В конце мая, перед стерелизацией, анализы были очень хорошие… Возможно ли, что при операции была занесена инфекция?
Спасибо.
(кросс-пост в ru-vet)

Холангиогепатит у кошек — Больница для домашних животных BluePearl

Холангиогепатит: диагностика, лечение и прогноз

Узнайте об этом кошачьем заболевании печени от специалистов BluePearl. Холангиогепатит — это распространенная форма заболевания печени, которая может поражать кошек любого возраста и породы.

У кошек с этим заболеванием развивается воспаление печени и желчных протоков (небольших сосудов в печени), которое иногда связано с другими сопутствующими заболеваниями.

Воспаление – это инвазия из кровотока различных типов лейкоцитов, которые активны в иммунной системе.

Холангиогепатит классифицируется как острое заболевание (называемое гнойным) или хроническое заболевание (негнойный). Молодые коты чаще болеют острым холангиогепатитом, чем кошки.

Функции печени

Печень отвечает за множество важных

функций, включая метаболизм углеводов и жиров, синтез белков и витаминов, запасание витаминов и железа, выработку веществ, необходимых для свертывания крови, и удаление или расщепление токсинов.

Поскольку печень участвует во многих важнейших биологических функциях, у кошки с заболеванием печени могут проявляться разнообразные симптомы. Они могут включать вялость, анорексию (потерю аппетита), потерю веса, слабость, желтуху (пожелтение кожи, глаз и десен), рвоту, диарею и изменения поведения. Некоторым кошкам диагноз ставится на ранней стадии заболевания, до того, как у них появятся клинические признаки.

Диагностика

Подозрение на заболевание печени подтверждается физическим осмотром, тщательным сбором анамнеза, включая диету и лекарства, комплексным анализом крови и ультразвуковым исследованием брюшной полости.

Для окончательного диагноза холангиогепатита требуется биопсия печени. Биопсия может быть выполнена хирургическим путем, с помощью лапароскопии или через кожу с помощью специальной иглы под ультразвуковым контролем. Биопсия под ультразвуковым контролем, к сожалению, не так информативна, как хирургическая или лапароскопическая биопсия.

Информация, полученная в результате биопсии, необходима для определения типа и тяжести заболевания печени, а также для оценки прогноза состояния вашей кошки и выбора подходящих вариантов лечения.Некоторые кошки с холангиогепатитом имеют сопутствующий хронический панкреатит (воспаление поджелудочной железы) и/или воспалительное заболевание кишечника (воспаление желудка и тонкого кишечника).

Когда у кошки одновременно наблюдаются все три заболевания, это называется триадитом. Существуют специальные анализы крови, которые помогают ветеринару определить, есть ли у вашей кошки такое сочетание заболеваний. Часто во время биопсии печени для анализа берут небольшие образцы кишечника вашей кошки.

Лечение

Лечение холангиогепатита может быть комплексным и определяется тяжестью и видом патологического процесса в печени, а также других сопутствующих органах.В тяжелых случаях может потребоваться госпитализация, внутривенная инфузионная терапия и поддерживающая терапия.

Острый холангиогепатит

часто лечат антибиотиками длительного действия, препаратами для поддержки регенерации печени, антиоксидантами и иногда другими добавками. Лекарства, обычно используемые при хроническом холангиогепатите, включают иммунодепрессанты или противовоспалительные препараты в дополнение к лекарствам, перечисленным выше.

Планы лечения кошек с другими сопутствующими заболеваниями, такими как хронический панкреатит или воспалительное заболевание кишечника, включают комбинацию лекарств и диеты, которые помогают лечить каждый из этих болезненных процессов.

Прогноз

Печень обладает удивительной способностью к регенерации, если основное заболевание можно вылечить. Кошки с инфекцией печени могут полностью выздороветь при соответствующем длительном лечении.

Прогноз для кошек с хроническим холангиогепатитом более осторожный. Некоторые кошки могут быть клинически здоровыми в течение длительного периода времени, в то время как у других кошек могут быть периодические эпизоды болезни. Большинству кошек требуется пристальное наблюдение ветеринара на протяжении всей оставшейся жизни.Это может включать периодические медицинские осмотры с анализом крови, смену лекарств и иногда повторную диагностику, например, УЗИ брюшной полости.

Для получения дополнительной информации по этому вопросу обратитесь к ветеринару, лечащему вашего питомца.

Новый гепаднавирус вызывает хронический гепатит и гепатоцеллюлярную карциному у кошек

Вирусы. 2019 Октябрь; 11(10): 969.

Джон С. Мандей

4 Школа ветеринарии, Университет Мэсси, Палмерстон-Норт 4410, Новая Зеландия; зн[email protected]

4 Школа ветеринарии Университета Мэсси, Палмерстон-Норт 4410, Новая Зеландия; [email protected]

Поступила в редакцию 3 октября 2019 г.; Принято 15 октября 2019 г.

Лицензиат MDPI, Базель, Швейцария. Эта статья находится в открытом доступе и распространяется в соответствии с условиями лицензии Creative Commons Attribution (CC BY) (http://creativecommons.org/licenses/by/4.0/). Эта статья цитировалась в других статьях в PMC. .

Abstract

В 2015 г. более 850 000 человек умерли от хронического гепатита и гепатоцеллюлярной карциномы (ГЦК), вызванных вирусом гепатита В (ВГВ).Недавно у домашних кошек был обнаружен новый вирус, подобный гепатиту В. Патогенный потенциал гепаднавируса домашних кошек (DCH), виремией которого страдают от 6,5% до 10,8% домашних кошек, неизвестен. Мы оценили хранящиеся в фиксированном формалином и залитые парафином биопсии больной и нормальной кошачьей печени на наличие DCH с помощью ПЦР и гибридизации in situ (ISH). ГЦК был обнаружен в 43% (6/14) случаев хронического гепатита и 28% (8/29) ГЦК, тогда как холангит ( n = 6), билиарная карцинома ( n = 18) и нормальная печень ( n = 15) все тесты на DCH были отрицательными.Кроме того, в случаях, связанных с DCH, гистологические особенности воспаления и неоплазии, а также распределение вируса на ISH были поразительно сходны с теми, которые наблюдаются при заболевании, связанном с HBV. Несколько гистологических признаков, характерных для гепатита, ассоциированного с HBV, включая фрагментарные некрозы и апоптотические тельца, были выявлены в DCH-положительных случаях хронического гепатита. В двух исследованных случаях ГЦК индекс пролиферации в ISH-положительных регионах был выше, чем в ISH-отрицательных регионах.Внутриклеточное распределение вируса как при гепатите, так и при ГЦК продемонстрировало, что вирусная нуклеиновая кислота присутствует как в ядерной, так и в цитоплазматической формах. В совокупности эти результаты демонстрируют убедительную связь между DCH и некоторыми случаями хронического гепатита и гепатоцеллюлярной карциномы у кошек, что отражает особенности гепатопатий, связанных с HBV. Необходимы дальнейшие исследования вирусной эпидемиологии и естественного течения, чтобы установить влияние DCH на здоровье кошек.

Ключевые слова: кошачьих, рак, вирус, кошка, ВГВ, ГЦК, заболевание, онкогенез, патология, Ортогепаднавирус , гепатология

1.Введение

Hepadnaviridae представляет собой семейство частично двухцепочечных ДНК-вирусов, обладающих узким кругом хозяев и сильным гепатотропизмом. Более 257 миллионов человек хронически инфицированы типовым видом вируса гепатита В (ВГВ) [1]. Хроническая инфекция HBV может спровоцировать иммуноопосредованный хронический гепатит, который характеризуется некрозом, регенерацией и фиброзом, прогрессирующим до цирроза печени и гепатоцеллюлярной карциномы (ГЦК) [2]. Сложный патогенез HBV-ассоциированных гепатопатий и взаимодействие между вирусом и различными факторами риска остаются не до конца изученными [3].Несмотря на эффективную вакцину против ВГВ, остаются серьезные проблемы для глобальной борьбы с ВГВ.

В 2018 году был обнаружен новый природный гепаднавирус, гепаднавирус домашней кошки (DCH) [4]. Инфекция DCH, по-видимому, распространена у кошек с виремией, обнаруженной у 6,5% и 10,8% домашних кошек в Австралии и Италии соответственно [4,5]. Потенциал DCH способствовать заболеванию печени кошек, если таковые имеются, еще не известен. Повышение вирусной нагрузки и уровня аланинаминотрансферазы (АЛТ) в сыворотке крови, биомаркеров прогрессирования HBV, у некоторых кошек, инфицированных DCH, косвенно подтверждает возможную роль DCH в заболевании печени кошек [5].Хронический гепатит и ГЦК, потенциальные последствия HBV-инфекции у людей, также встречаются у домашних кошек, но считаются идиопатическими у этого вида [6]. В этом международном многоцентровом исследовании мы использовали ПЦР и гибридизацию in situ (ISH) для выявления гепатотропизма, клеточных мишеней и распределения DCH в нормальных и больных образцах кошачьей печени.

2. Материалы и методы

2.1. Выбор случая и ткани

Образцы кошачьей печени, фиксированные формалином и залитые парафином (FFPE), были получены из 4 учреждений в 4 странах (Калифорнийский университет в Дэвисе, США; Университет Сиднея, Австралия; Университет Мэсси, Новая Зеландия; патологии, Бристоль, Великобритания).Образцы были получены либо путем обычной биопсии, либо вскрытия, и все они были собраны с согласия владельца. Были отобраны случаи, которые представляли собой спектр часто диагностируемых заболеваний печени у кошек. Включение в исследование требовало наличия гистологических срезов, позволяющих подтвердить микроскопические признаки, соответствующие диагнозу. Слепой гистологический обзор проводился одним патологом (PP) для окончательной классификации. Случаи хронического (пограничного) гепатита были отобраны с использованием текущего международно принятого определения [7].В случаях, идентифицированных как холангит, воспаление четко сосредоточивалось на желчных протоках или вокруг них без воздействия или только с регионарным выпадением гепатоцитов. В случаях, классифицированных как ГЦК, наблюдалась потеря дольковой архитектуры, утолщение гепатоцеллюлярных тяжей, дольковая компрессия и/или инвазия и клеточная атипия от легкой до выраженной. Нормальный контроль печени определяли по отсутствию каких-либо гистологических признаков заболевания и нормальной концентрации АЛТ в сыворотке. Случаи и контроли были дополнительно отобраны на основе качества (отсутствие аутолитических изменений, <1 неделя в 10% забуференном формалине) и количества отобранной ткани печени.Были включены только образцы с адекватной сохранностью нуклеиновой кислоты, основанной на амплификации GAPDH в ДНК.

2.2. Экстракция ДНК

Срезы FFPE кошачьей печени толщиной 25 мкМ трижды депарафинизировали 1 мл ксилола и промывали 1 мл 100% этанола, 1 мл 90% этанола и 1 мл 70% этанола. Ткань расщепляли в течение ночи в 180 мкл буфера Qiagen ATL и 20 мкл раствора протеиназы К. ДНК очищали с использованием набора DNeasy Blood and Tissue (Qiagen, Hilden, Germany) в соответствии с инструкциями производителя и элюировали с использованием 100 мкл буфера для элюирования ДНК и хранили при -20 °C.

2.3. Обычные ПЦР-анализы

Для скрининга ДНК, выделенной из печени FFPE, на наличие DCH использовали два обычных ПЦР-анализа (кПЦР). Набор праймеров 1 (Hgap-F/Hgap-R) [4] амплифицирует участок вирусного генома размером 230 п.н., а набор праймеров 2 (FeHep.2116F (GCACCTGGATTCGCACAC)/FeHep.2371R (CCTTGAGGGAGTAAAGCCCTG)) амплифицирует участок 256 п.н. ). 25 мкл реакционной смеси содержали 12,5 мкл HotStarTaq Plus Master Mix (Qiagen), 0,5 мкМ прямого праймера, 0,5 мкМ обратного праймера, 2,5 мкл красителя и 100–200 нг очищенной ДНК.Условия циклирования: начальный этап активации при 95 °C в течение 5 минут, затем 40 циклов при 94 °C в течение 30 с, 55 °C в течение 30 с (52 °C для набора праймеров 2) и 72 °C в течение 30 с. , с конечной стадией элонгации при 72 ° C в течение 10 мин. Ампликоны оценивали электрофорезом в 1,5% агарозном геле. Идентичность полос правильного размера подтверждали клонированием с использованием набора для клонирования TOPO TA (Invitrogen, Thermo Fisher Scientific, Уолтем, Массачусетс, США), секвенированием по Сэнгеру (центр для секвенирования ДНК, Калифорнийский университет в Дэвисе).

Геном гепаднавируса домашней кошки.Есть четыре ORF. Зонды ПЦР, используемые для этого исследования (синие), частично перекрываются и охватывают соединение между коровым геном и геном полимеразы. Гены core и полимеразы в ортологическом вирусе гепатита B (HBV) необходимы для репликации. Зонд ISH V-FeHepadnavirus (желтый) представляет собой набор парных зондов из 20 ZZ, гибридизующихся с ДНК-мишенью или транскриптом генов X и полимеразы.

2.4. Гибридизация in situ

Мы разработали антисмысловой зонд V-FeHepadnavirus (Advanced Cell Diagnostics, Inc., Хейворд, Калифорния, США), нацеленный на регион 604–1477 DCH, регистрационный номер Genbank Mh4079301 () [4]. Случаи, которые дали положительный результат на DCH с помощью cPCR и отрицательных контрольных тканей, были переведены в ISH. Колориметрический ISH выполняли вручную на срезах ткани FFPE размером 5 мкм на предметных стеклах Superfrost Plus (Fisher Scientific, Питтсбург, Пенсильвания, США) с использованием набора для анализа RNAscope 2.5 Red (Advanced Cell Diagnostics, Inc.). Каждый срез предварительно обрабатывали теплом и протеазой перед гибридизацией зонда в течение 2 ч при 40°С.

Для подтверждения сигнала использовались отрицательные контрольные зонды для зондирования серийных срезов, включая зонд, предназначенный для обнаружения дигидродипиколинатредуктазы (DapB) Escherichia coli (все случаи). Неинфицированная, гистологически нормальная ткань кошачьей печени служила отрицательным тканевым контролем ( n = 3). Предметные стекла были контрастно окрашены гематоксилином и смонтированы с помощью EcoMount (Biocare Medical, Concord, CA). Слайды были оцифрованы с использованием сканера Olympus VS120 и объектива 40× со светлопольным освещением.

2.5. Иммуногистохимия

Для ГЦК, связанного с DCH, индекс пролиферации определяли в двух репрезентативных случаях с помощью иммуногистохимии с использованием мышиного моноклонального антитела против Ki67, MIB1 (Agilent, DAKO, Санта-Клара, Калифорния, США). Выделение антигена проводили паром в течение 30 мин. Индекс пролиферации рассчитывали в 10 полях большого увеличения, каждое из которых содержало вирусоположительные и вирусоотрицательные участки, и представляли как процент Ki67-позитивных клеток по отношению к общему числу гепатоцитов.

3. Результаты

3.1. Случаи и контроль

Всего были включены биопсии 71 отдельной кошки с 80 поражениями; хронический гепатит ( n = 14), холангит ( n = 6), ГЦК ( n = 29), билиарная карцинома ( n = 18), узловая гиперплазия ( n = 8), многоочаговая билиарная карцинома кисты ( n = 4) и токсическая (аманитиновая) гепатопатия ( n = 1). Узловая гиперплазия и кисты в некоторых случаях сопутствовали гепатиту или обнаруживались в нормальной печени.Пятнадцать образцов нормальной печени служили контролем.

3.2. Обнаружение DCH в биоптатах печени кошек

С помощью ПЦР ДНК DCH была амплифицирована в 6 из 14 (43%) случаев хронического гепатита и 8 из 29 (28%) ГЦР. ДНК DCH не амплифицировали ни из одного образца билиарной карциномы, холангита, узловой гиперплазии, многокамерных билиарных кист, токсической гепатопатии или из нормальной печени. Два из 6 DCH-положительных случаев хронического гепатита были положительными по ISH, тогда как все ПЦР-положительные HCC также были положительными по DCH по ISH ().

Таблица 1

Обнаружение гепаднавируса домашней кошки (DCH) в кошачьей печени с помощью ПЦР и ISH.

гепатоцеллюлярной карциномы
Гистопатологический диагноз Количество случаев DCH положительный
СПСР ISH
29 8/29 8/8
Дискенизия карциномы 18 0/18 0/11
Гепатит 14 6/14 2/14 2/6
Cholangitis 6 0/6 0/5
Другое 1 13 0/4 0/3
Нормальная печень 2 15 0/15 0/3

3.3. Характер поражений, связанных с DCH, по традиционной патологии и ISH

3.3.1. Хронический гепатит

В случаях хронического гепатита с положительным результатом ПЦР на DCH было выявлено лимфоцитарное перипортальное воспаление (A), с некоторыми областями, включающими воспаление на портально-лобулярном интерфейсе, характерное для «фрагментарного некроза». Лимфоциты и плазматические клетки также были рассеяны в синусоидальных пространствах, где они иногда группировались. Нейтрофилы встречались редко, а если и присутствовали, то были связаны с областями отдельных клеток или некрозом поверхности раздела.Фиброз неравномерно охватывал портальные области и кратко расчленялся на регионарные синусоиды. Все случаи хронического гепатита, связанные с ДКГ, а также несколько случаев ДКГ-отрицательных, имели очаги от легкой до выраженной гепатоцеллюлярной дисплазии и узловые или плохо отграниченные области вакуолизированных гепатоцитов (С).

Хронический гепатит, ассоциированный с DCH ( A D ) и гепатоцеллюлярная карцинома, ассоциированная с DCH ( E G ). ( A ) Лимфоциты сгруппированы вблизи портальных трактов (стрелка) и внутри синусоидов.Разрозненные группы гепатоцитов разного размера вакуолизированы (звездочка). Отдельный гепатоцит (стрелка) гиперэозинофильный и индивидуализированный (некроз). Вставка, обзор, медиальная доля. Гематоксилин и эозин, Bar = 50 мкм. ( B ) Хронический гепатит, гибридизация in situ. На вставке в этом обзоре с малым увеличением показана гибридизация зонда DCH (красный) в подавляющем большинстве срезов. Коллапсированные дольки и фиброзные тяжи не гибридизуются (звездочки). DCH ISH демонстрирует сочетание ядерной (стрелки) и цитоплазматической гибридизации, ISH, Bar = 50 мкм.( C ) Имеются рассеянные области вакуолярной дегенерации. Гематоксилин и эозин. ( D ) В серийном срезе гибридизация зонда ограничивается эксцентричными «точками» внутри ядер. ИШ. Бар = 50 мкм. ( E ) HCC, связанный с DCH, с использованием зонда ISH для DCH при малом увеличении (вставка, вверху) демонстрирует узелковую область HCC с интенсивной цитоплазматической гибридизацией (стрелка), которая видна при большем увеличении на большей панели. Бар = 50 мкм. При использовании контрольного зонда гибридизация на серийном срезе того же узелка (вставка, внизу) и ( F ) отсутствует.( G ) В других областях опухоли гибридизация зондов более вариабельна. Звездочками обозначена граница гепатоцитов с ядерной и цитоплазматической гибридизацией (слева), непосредственно примыкающая к гепатоцитам, где определяемая гибридизация была ограничена цитоплазмой (справа).

Характер гибридизации в случаях хронического гепатита, связанного с DCH, был пятнистым (B). Области, которые были диффузно и сильно положительными, примыкали к другим областям, у которых была скудная гибридизация или ее отсутствие.Региональная вариация обычно соответствовала узелкам (вставка вверху). Характер гибридизации внутри отдельных клеток также различался. Большинство гепатоцитов, которые были положительными на DCH при гибридизации зонда, имели комбинацию ядерных и цитоплазматических сигналов (B), но в некоторых отдельных гепатоцитах гибридизация зонда была ограничена эксцентричной одиночной «точкой» внутри ядра (D).

3.3.2. Гепатоцеллюлярная карцинома

Новообразования, характеризуемые как ГЦК, были инвазивными, демонстрировали потерю дольковой архитектуры, а в большинстве неопластических областей синусоиды были либо неаппарентными (солидными), либо гепатоцеллюлярными тяжами с глубоким скоплением.Имелась вариабельная клеточная атипия, и большинство случаев ГЦР содержали очаги сливного некроза. Вакуолярная дегенерация наблюдалась в DCH-позитивных HCC и интерпретировалась как комбинация жировых изменений и накопления гликогена на основании окрашивания периодической кислотой-Шиффом.

Как и в случае с гепатитом, ассоциированным с DCH, во всех ГЦК, где гибридизация была цитоплазматической (Е), во всех ГЦК, где гибридизация была цитоплазматической (Е), были рассеяны в виде кластеров, но в других регионах имелась ядерная локализация. Изменчивость в обнаружении была поразительной (E, вставка.верх). Целые узелки опухолевых клеток могут быть диффузно, интенсивно положительными и иногда примыкать к другим узелкам с меньшей или полностью отсутствующей гибридизацией зондов. Ядерная гибридизация была либо диффузной, либо ограничивалась эксцентричной «точкой» сигнала на периферии ядра или заполняла ядро ​​(G). Изменчивость обнаружения вируса позволила оценить индекс пролиферации в каждом отдельном случае. Области гибридизации зонда DCH с помощью ISH имели более высокий индекс пролиферации (10–20 на HPF), чем не связанные с вирусом области (1–2 на HPF, ).HE = гематоксилин и эозин; DCH = ISH с использованием зонда для нуклеиновой кислоты гепаднавируса домашней кошки; CTL = контрольный датчик ISH.

Ki67 иммуногистохимия DCH-отрицательной области HCC ( A ) и DCH-положительной области HCC ( B ). Вирусположительные области определяли с помощью ISH. Стрелки как в ( A ), так и в ( B ) обозначают ядра гепатоцитов, экспрессирующие Ki67. Клеточный цикл выше в областях опухоли, положительных на DCH.

3.4. DCH-отрицательные поражения

Нормальная печень, карциномы желчных путей, многокамерные билиарные кисты и токсическая гепатопатия были отрицательными для DCH по ISH.

4. Обсуждение

Гепаднавирусы, которые естественным образом инфицируют приматов, летучих мышей и грызунов, вызывают заболевания печени, включая хронический гепатит и ГЦК, но патогенез этих гепатопатий остается не до конца изученным [8,9]. Здесь впервые показано, что кошачий гепаднавирус связан с поражениями, отражающими патологии, вызванные HBV. Кроме того, в случаях, связанных с DCH, гистологические особенности воспаления и неоплазии, а также распределение вируса были поразительно сходны с теми, которые наблюдаются при заболевании, связанном с HBV.

Несколько микроскопических признаков, которые согласуются с ВГВ-ассоциированным гепатитом человека, но не патогномоничны для него, включая «частичный» некроз, апоптотические тельца и синусоидальное воспаление [10], были идентифицированы в сочетании в случаях хронического гепатита, ассоциированного с ГВ, но не при DCH-негативном гепатите. Точно так же характер ГЦР, связанного с ГЦК, имеет общие черты с гепатопатиями, вызванными HBV и/или вирусом гепатита сурков, включая области вакуолярных изменений и отдельные гепатоцеллюлярные некрозы, хотя отдельные гистологические особенности ГЦК не позволяют отличить ГЦК-положительные от ГЦК-отрицательных случаев.Следует отметить большую пролиферацию гепатоцитов, наблюдаемую в областях ГЦК, связанных с ГЦК, по сравнению с вируснегативными областями, поскольку пролиферация гепатоцитов, вызванная иммунным ответом хозяина, способствует трансформации гепатоцитов в ГЦК, связанной с ВГВ [11]. Согласованность этого вывода теперь должна быть проверена на большем количестве ГЦК, связанных с DCH. HBV-ассоциированный HCC обычно возникает на фоне хронического воспаления и цирроза печени [12]. Хотя гистологический характер хронического гепатита, связанного с DCH и HBV, сходен, необходимы проспективные исследования, чтобы установить прогрессирование заболевания от воспаления до неоплазии.

В ходе репликации гепаднавирусы продуцируют формы внутриядерной ДНК, в том числе персистентную, ковалентно замкнутую кольцевую ДНК и интегрированный вирус, а также множественные цитоплазматические мРНК [13]. Антисмысловой зонд ISH, использованный в этом исследовании, предназначен для обнаружения РНК, но в случае двухцепочечных ДНК-вирусов зонд также обнаруживает смысловую цепь геномной ДНК. Паттерн гибридизации, выявленный в DCH-позитивных тканях, был регионально смешанным как по интенсивности, так и по внутриклеточному распределению (цитоплазматический, ядерный или оба).Этот паттерн согласуется со сложным жизненным циклом HBV и других гепаднавирусов [13]. Направленные геноспецифические зонды ISH могут помочь в дальнейшей разработке жизненного цикла DCH.

Анализ ISH для обнаружения DCH, разработанный и утвержденный здесь, расширяет возможности, доступные для обнаружения вирусов. Хотя и ПЦР, и ISH могут выявить инфекцию DCH, отрицательный результат любого теста не исключает инфекции. ISH более чувствителен, чем ПЦР, поскольку он может обнаруживать отдельные инфицированные DCH клетки, но для ISH берется лишь небольшое количество клеток, что может не отражать все патологические процессы в печени.Это может объяснить, почему только два из шести ПЦР-положительных случаев хронического гепатита были положительными для DCH на ISH, в отличие от всех PCR-положительных HCC. Если DCH-инфицированные клетки встречаются при гепатите реже, чем HCC, эти клетки могут быть не включены в биопсию. В качестве альтернативы результат ПЦР может отражать виремию, а не инфекцию гепатоцитов в четырех случаях ISH-отрицательного гепатита.

В совокупности результаты этого молекулярного и морфологического исследования демонстрируют убедительную связь между DCH и некоторыми случаями хронического гепатита и HCC.Сходство между присутствием и распределением вируса в этих поражениях у кошек и гепатопатиями у человека и сурка, вызванными HBV и WHV соответственно, позволяет предположить, что DCH может быть одной из причин хронического гепатита и HCC у кошек. Однако есть и другие объяснения нашим выводам. Обнаружение вируса в этих поражениях может быть совпадением или следствием заболевания, возможно, из-за локальной активизации репликации вируса.

Потенциальное влияние DCH на здоровье кошек будет представлять большой интерес для мирового ветеринарного сообщества из-за популярности кошек как животных-компаньонов человека [14].Хронический гепатит, по-видимому, редко встречается у кошек, частота его возникновения составляет 2,4% всех кошачьих биопсий печени [6]. По оценкам, первичная неоплазия печени составляет от 1% до 2,9% всех видов рака [15,16]. Билиарная карцинома и ГЦК встречаются с частотой 17% и 27% всех новообразований печени кошек [6]. В наших коллекциях из США и Великобритании за последние 10 лет ГЦК был наиболее частым первичным эпителиальным раком печени (ГЦК = 71/132, 54%). С другой стороны, в двух небольших исследованиях, проведенных на сегодняшний день, виремия DCH была обнаружена более чем у 10% кошек в зависимости от тестируемой популяции [4,5].Возможно, заболевание печени у кошек недооценивается, потому что ветеринарные диагностические исследования часто ограничены, а биопсия, особенно биопсия с помощью иглы, может не отражать патологические процессы во всей печени. Является ли инфекция DCH апатогенной или связана с субклиническим или клиническим заболеванием у кошек, еще предстоит определить. Проспективное клиническое исследование кошек с виремией DCH поможет понять влияние DCH на здоровье кошек. Если DCH будет идентифицирован как кошачий возбудитель, тогда можно будет исследовать потенциал обратной трансляции лечения и профилактики HBV для кошек.

Благодарности

Авторы выражают благодарность Н. Дж. Маклахлану и Дж. Каллену за советы, интерпретацию и опыт работы с моделями животных.

Вклад авторов

Концептуализация, J.A.B. и П.А.П.; методология, JAB, PAP и KJ; расследование, П.А.П., К.Дж., Дж.А.Б., В.Р.Б., Б.Х. и Т.Т.; курирование данных, PP, JAB, TS и JSM; написание — подготовка первоначального проекта, J.A.B. и П.А.П.; написание — рецензирование и редактирование, все авторы; надзор, П.А.П., К.Дж., Дж.А.Б. и В.Р.Б.; приобретение финансирования, J.A.B. и П.А.П.

Финансирование

Это исследование финансировалось фондом Winn Feline Foundation (MT18-005), наградой за сотрудничество Университета Сиднея и Калифорнийского университета в Дэвисе (2018 г.), Центром здоровья домашних животных Калифорнийского университета в Дэвисе и Общество защиты кошек Нового Южного Уэльса, Австралия.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Ссылки

1.Всемирная организация здравоохранения. Доклад о глобальном гепатите, 2017 г. Всемирная организация здравоохранения; Женева, Швейцария: 2017. [Google Scholar]2. Гвидотти Л.Г., Исогава М., Чисари Ф.В. Взаимодействия вируса-хозяина при инфицировании вирусом гепатита В. Курс. мнение Иммунол. 2015;36:61–66. doi: 10.1016/j.coi.2015.06.016. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]3. Фаттович Г., Бортолотти Ф., Донато Ф. Естественная история хронического гепатита В: особое внимание прогрессированию заболевания и прогностическим факторам. Дж.Гепатол. 2008; 48: 335–352. doi: 10.1016/j.jhep.2007.11.011. [PubMed] [CrossRef] [Google Scholar]4. Агазаде М., Ши М., Баррс В.Р., Маклаки А.Дж., Линдси С.А., Джеймсон Б., Хэмпсон Б., Холмс Э.К., Битти Дж.А. Новый гепаднавирус обнаружен у домашней кошки с ослабленным иммунитетом в Австралии. Вирусы. 2018;10:269. doi: 10.3390/v10050269. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]5. Ланаве Г., Капоцца П., Диакуди Г., Кателла К., Катуччи Л., Герго П., Стази Ф., Баррс В., Битти Дж., ДеКаро Н., и другие. Идентификация гепаднавируса в сыворотке крови кошек. науч. Отчет 2019; 9:10668. doi: 10.1038/s41598-019-47175-8. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]6. Bayton W.A., Westgarth C., Scase T., Price D.J., Bexfield NH. Гистопатологическая частота кошачьих гепатобилиарных заболеваний в Великобритании. Дж. Смолл Аним. Практика. 2018;59:404–410. doi: 10.1111/jsap.12810. [PubMed] [CrossRef] [Google Scholar]7. Ван ден Инг Т.С.Г., Ван Винкл Т., Каллен Дж.М., Чарльз Дж.А., Десмет В.Дж. Морфологическая классификация паренхиматозных заболеваний печени собак и кошек: 2.Гепатоцеллюлярная смерть, гепатит и цирроз. В: Ротуизен Дж., Банч С.Э., Чарльз Дж.А., Каллен Дж.М., Десмет В.Дж., Сатмари В., Тведт Д.К., ван ден Инг Т.С., Ван Винкль Т., Вашабау Р.Дж., редакторы. Стандарты WSAVA для клинической и гистологической диагностики заболеваний печени собак и кошек. Сондерс; Эдинбург, Великобритания: 2006. стр. 85–101. [Google Академия]9. Дрекслер Дж. Ф., Гейпель А., Кениг А., Корман В. М., Ван Риэль Д., Лейтен Л. М., Бремер С. М., Раше А., Коттонтейл В. М., Маганга Г. Д. и др. Летучие мыши являются переносчиками патогенных гепаднавирусов, антигенно родственных вирусу гепатита В и способных инфицировать гепатоциты человека.проц. Натл. акад. науч. США. 2013;110:16151–16156. doi: 10.1073/pnas.1308049110. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]10. Десмет В. Дж., Гербер М., Хуфнагл Дж. Х., Маннс М., Шойер П. Дж. Классификация хронического гепатита: диагностика, классификация и постановка. Гепатология. 1994; 19: 1513–1520. doi: 10.1002/hep.1840190629. [PubMed] [CrossRef] [Google Scholar] 11. Дандри М., Петерсен Дж. Механизм персистенции вируса гепатита В в гепатоцитах и ​​его канцерогенный потенциал. клин. Заразить. Дис.2016;62:S281–S288. doi: 10.1093/cid/ciw023. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]12. Ян Дж.Д., Ким В.Р., Коэльо Р., Меттлер Т.А., Бенсон Дж.Т., Сандерсон С.О., Терно Т.М., Ким Б., Робертс Л.Р. Цирроз присутствует у большинства пациентов с гепатитом В и гепатоцеллюлярной карциномой. клин. Гастроэнтерол. Гепатол. 2011; 9: 64–70. doi: 10.1016/j.cgh.2010.08.019. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]13. Танг Л.С.И., Коверт Э., Уилсон Э., Коттилил С. Обзор хронической инфекции гепатита В.Варенье. Мед. доц. 2018; 319:1802–1813. doi: 10.1001/jama.2018.3795. [PubMed] [CrossRef] [Google Scholar] 14. Американская ветеринарная медицинская ассоциация. Справочник по владельцам домашних животных и демографическим данным AVMA (2017–2018 гг.) Американская ветеринарная медицинская ассоциация; Шаумбург, Иллинойс, США: 2018. [Google Scholar]15. Хаммер А.С., Сиккема Д.А. Неоплазия печени у собак и кошек. Ветер. клин. Н. Ам. Малый Аним. Практика. 1995; 25: 419–435. doi: 10.1016/S0195-5616(95)50035-X. [PubMed] [CrossRef] [Google Scholar] 16. Каллен Дж.М. Опухоли у домашних животных. Уайли; Хобокен, Нью-Джерси, США: 2016. Опухоли печени и желчного пузыря; стр. 602–631. [Google Scholar]

Гепатит С и кошачьи царапины

Недавно мне позвонили по поводу риска передачи гепатита С через кошачьи царапины. Гепатит С — это человеческий вирус, который может вызвать серьезное заболевание печени. Чаще всего он передается через кровь инфицированных людей. В этом случае кошек беспокоило, существует ли риск передачи, если кошка поцарапает кого-то с гепатитом С, а затем поцарапает кого-то еще.

Случаев передачи гепатита С через кошачью царапину не зарегистрировано. Для передачи должно произойти следующее:

  • Кошка должна поцарапать инфицированного человека, у которого в крови циркулирует вирус гепатита С.
  • В царапине должна быть кровь, которая затем загрязняет когти кошки.
  • Вирус должен выжить на кошачьих когтях.
  • Кошка должна поцарапать кого-то достаточно глубоко, чтобы потекла кровь.
  • Вирус гепатита С должен попасть из когтей кошки в кровоток человека и выжить.

Вероятность того, что эта последовательность произойдет, очень мала. Это похоже на опасения по поводу передачи ВИЧ от укусов собак — теоретически возможно, никогда не доказано и, вероятно, вызывает очень мало беспокойства.

Это можно рассматривать как аналогичную ситуацию с уколом иглой у людей: кто-то берет кровь у инфицированного человека, а затем тут же случайно укалывает палец иглой. Гепатит С не передается через уколы иглой; всего около 1.У 8 % людей, уколовшихся таким образом (иглой, зараженной кровью человека, инфицированного гепатитом С), вырабатываются антитела против вируса. Риск выше при использовании полых игл (например, используемых для инъекций и забора крови) по сравнению с иглами, используемыми для наложения швов, из-за большего объема крови, который может быть перенесен через иглу с полым отверстием. Кошачьи царапины, по-видимому, больше похожи на проколы хирургической иглой — зараженная кровь может быть только на внешней стороне когтя, а не внутри него.

Единственным случаем, когда у меня может быть какое-либо беспокойство, было бы, если бы я получил серьезную царапину от кошки, которая непосредственно перед этим причинила серьезную травму человеку, инфицированному гепатитом С, например, в ситуации, когда два человека разгоняли кошачью драку или когда кто-то пытался оторвать атакующую кошку от другого человека. Это очень маловероятный сценарий, и связанный с ним риск все равно будет чрезвычайно низким.

Итог: не беспокойтесь о гепатите С, если рядом есть кошки и инфицированные люди.Используйте меры здравого смысла, чтобы всегда избегать царапин.

Источник изображения: www.gooddog.co.uk

Новый вирус, похожий на вирус гепатита В, обнаружен у кошек

Когда кот Джулии Битти Джаспер умер от болезни сердца, ей и в голову не пришло, что его смерть приведет к прорывному открытию вируса, ранее неизвестного у кошек. Но теперь образцы его тканей помогли Битти и другим австралийским исследователям идентифицировать новое кошачье заболевание: гепаднавирус домашних кошек.

Вирус принадлежит к тому же семейству, что и гепатит В, поражающий людей, и обнаружение кошачьей версии может оказать влияние на медицинские исследования человека, а также на здоровье кошек.

Помимо того, что он владелец кошки, Битти, BVetMed, PhD, FANZCVSc, является профессором кошачьей медицины в Школе ветеринарии Сиднейского университета. Она была частью группы исследователей, которые обнаружили новый гепаднавирус во время поиска вызывающих рак вирусов в ткани кошки с ослабленным иммунитетом, которая умерла от лимфомы.

В этом месяце они опубликовали свои выводы в журнале Viruses .

Исследователи, финансируемые Фондом животных Морриса, смогли составить карту полного генома нового вируса, а затем протестировали ранее сохраненные образцы от других домашних кошек, включая Джаспера.

Хотя Джаспер умер от болезни сердца, на момент смерти у него также был диагностирован кошачий вирус иммунодефицита (FIV), кошачий эквивалент ВИЧ/СПИДа, который является распространенным заболеванием, которое, скорее всего, сделало его восприимчивым к новому вирусу. гепатитоподобный вирус.

Когда Битти и ее коллеги исследовали другие образцы, они обнаружили новый вирус у 10% кошек с положительным результатом теста на ВИК и у 3,2% кошек, не инфицированных ВИК.

Битти отметил, что, хотя подобные вирусы могут вызывать гепатит и рак печени у других видов, недавно обнаруженный кошачий гепаднавирус не представляет опасности для людей или других домашних животных.

Битти сказал, что открытие было захватывающим по нескольким причинам: «До сих пор мы не знали, что животные-компаньоны могут заразиться этим типом инфекции.Очевидно, нам необходимо понять влияние этой инфекции на здоровье кошек».

И последствия не ограничиваются кошачьим здоровьем. «Как только мы узнаем о вирусе одного конкретного вида, он может иметь отношение и к другим видам», — сказал Битти.

«У нас есть вакцина против инфекции гепатита В [у людей], но мы до сих пор [полностью] не уверены, как она вызывает рак, и поэтому чем больше видов, о которых мы знаем, у которых есть эти вирусы, тем больше мы можем узнать о том, как этот тип вируса взаимодействует со своим хозяином, каким бы млекопитающим это ни было.

«Если мы сможем найти вирусы, вызывающие опухоли, тогда мы сможем создать вакцину, которая защитит от вируса, — сказал Битти. — Особенно интересно, если вакцина сможет предотвратить развитие рака в будущем у кошек с ослабленным иммунитетом или других уязвимых кошек».

И хотя Битти все еще скучает по Джасперу, она рада, что он смог помочь.

Фото: © iStock/Natali_Mis

Молекулярное обнаружение и характеристика гепаднавируса домашних кошек (DCH) из крови и тканей печени кошек в Малайзии | BMC Veterinary Research

Гепаднавирус домашних кошек (DCH) — новый представитель Hepadnaviridae , обнаруженный у домашних кошек ( Felis catus ) [1,2,3].Гепаднавирусы имеют сферическую форму диаметром 42–50 нм. Вирусный геном заключен в икосаэдрический капсид, окруженный двухслойной липидной мембраной. Вирусный геном состоит из кольцевой частично двухцепочечной молекулы ДНК [4, 5]. Гепаднавирусы можно разделить на пять родов в зависимости от хозяина: Ортогепаднавирус заражает млекопитающих, Авигепаднавирус заражает виды птиц, Герпетогепаднавирус заражает земноводных и рептилий, Метагепаднавирус и Парагепаднавирус Недавно идентифицированный DCH был классифицирован как Orthohepadnavirus [1].

Ортогепаднавирус имеет геном ДНК размером приблизительно 3,2 кб. Геном имеет четыре перекрывающиеся открытые рамки считывания (ORF), которые кодируют поверхностный (S), X, сердцевинный (C) и полимеразный (P) белки [9]. Несколько ортогепаднавирусов были выделены у различных приматов, включая людей, горилл, гиббонов, орангутангов, шерстистых обезьян и шимпанзе [10,11,12,13]. Ортогепаднавирусы также заражают других млекопитающих, включая сурков, сусликов, арктических белок и летучих мышей [14,15,16,17].

Хорошо известный вид-прототип этого семейства, HBV человека, был впервые обнаружен в 1966 году. Приблизительно 257 миллионов человек во всем мире являются носителями HBV, и ежегодно HBV вызывает 887 000 смертей, в основном из-за гепатоцеллюлярной карциномы (ГЦК, 62%) и цирроза ( 29%) [18]. Распространение ВГВ преобладает в различных географических регионах мира с высокой распространенностью, зарегистрированной в Азии, на Ближнем Востоке и в Африке. Различные генотипы HBV социркулируют в разных регионах, что увеличивает скорость геномной рекомбинации HBV [19].

Сообщалось также о том, что HBV является распространенным копатогеном у людей, инфицированных вирусом иммунодефицита человека (ВИЧ). Хроническая инфекция ВГВ встречается у 10% пациентов с коинфекцией ВГВ. Иммунная система больных ВИЧ имеет пониженную вероятность клиренса ВГВ, что приводит к повышению вирусной нагрузки ВГВ и развитию хронической ВГВ-инфекции [20]. Поскольку коинфекция ВГВ и ВИЧ часто встречается у людей, первоначальное исследование по обнаружению ГВ было сосредоточено на кошках, инфицированных вирусом иммунодефицита кошек (FIV).Распространенность DCH среди инфицированных FIV кошек составила 10%, что значительно выше, чем у кошек, не инфицированных FIV (3,2%) [1].

В Италии образцы сыворотки крови кошек, отправленные в диагностические лаборатории при клиническом подозрении на инфекционные заболевания, выявили высокую распространенность DCH до 17,8%; из них 33,3% кошек, инфицированных ретровирусами (FIV и вирусом кошачьей лейкемии, FeLV), также имели коинфекцию DCH [2]. Ланаве и др. [2] также обнаружили, что 7 из 10 случаев с подозрением на заболевание печени также были DCH-позитивными.Исследование, посвященное поражению печени кошек, проведенное Pesavento et al. [3], которые исследовали фиксированные формалином и залитые парафином (FFPE) ткани печени из четырех стран (США, Австралия, Новая Зеландия, Великобритания), продемонстрировали, что до 43% случаев хронического гепатита и 28% случаев ГЦК также были DCH-позитивными.

Кошки в возрасте от 4 до 7 месяцев имели более высокие шансы быть DCH-положительными, хотя и при p  = 0,08061, и без половой предрасположенности. Исследование гибридизации in situ (ISH) показало, что распространение вируса DCH в случаях ГЦК и хронического гепатита напоминает таковое при заболеваниях печени, связанных с HBV, у людей [3].Эти данные свидетельствуют о возможном сходном патогенезе DCH с HBV, при этом вирус может быть вовлечен в хроническое воспаление печени, ведущее в конечном итоге к канцерогенезу. Эта гипотеза требует дальнейших исследований.

Исследования по обнаружению ГКГ в парных образцах печени и крови одной и той же кошки еще не проводились. Парные результаты обнаружения улучшат наше понимание инфекции DCH на разных клинических фазах, наблюдаемых у пациентов с HBV, а именно. вирусоносители и иммунотолерантные пациенты, а также между активной и хронической фазами.Обычно более высокая нагрузка ДНК ВГВ в крови обнаруживается при острой инфекции или в активной хронической фазе инфекции [21, 22].

Открытие DCH в двух разных географических точках выявило два несовместимых штамма DCH: DCH Australia (3187 п.н., AUS/2016/Сидней) и DCH Italy (3184 п.н., ITA/2018/165 – 83) [1, 2]. Итальянский и австралийский штаммы имеют идентичность нуклеотидов на 97% [2]. Таким образом, определение полной последовательности генома малазийского DCH даст представление о генетической изменчивости этого вируса.

Здесь мы сообщаем о молекулярной распространенности DCH с использованием обычного ПЦР-анализа как цельной крови, так и образцов ткани печени из приютов и домашних кошек в Малайзии. Были оценены возможные факторы риска инфекции DCH, включая возраст, пол, тип собственности, повышение уровня аланинтрансаминазы (АЛТ) в сыворотке крови и коинфекцию FIV и FeLV. Кроме того, была определена полная последовательность генома местного (малайзийского) штамма и проведено сравнение с двумя штаммами DCH из Австралии и Италии.Был проведен филогенетический анализ, чтобы связать эволюцию малазийского штамма DCH с эволюцией других гепаднавирусов.

Гепатит у собак и кошек — Vetspace Рона Хайнса — 2-й шанс — The Animal Health Website

Рон Хайнс DVM PhD

Проблемы с печенью кошек? здесь и здесь

Новые препараты для печени? здесь

Эта статья была написана некоторое время назад. Теперь это в основном заглушка, которая приведет вас к другим, более новым и подробным статьям, связанным с печенью, а также к другим статьям, касающимся проблем со здоровьем, которые могут повлиять на печень вашей собаки или кошки.Если у вас есть кошка, и ваш ветеринар сказал вам, что они подозревают холангиогепатит, идите сюда. Если ваши ветеринары подозревают, что у вашей кошки липидоз печени, перейдите сюда. Если ваш ветеринар считает, что у вашей собаки проблемы с портосистемным шунтом печени, обратитесь сюда . Если они подозревают печеночную микродисплазию, идите сюда. Если они считают, что снижение умственных способностей вашего питомца связано с печеночной энцефалопатией, обратитесь сюда . Если тесты печени вашей собаки или кошки не соответствуют норме, перейдите сюда и сюда, чтобы найти конкретные тесты и различные причины, по которым они могут быть высокими.Если гепатит является осложнением заражения вашей собаки лептоспирозом, вам сюда. Если проблемы с печенью могут быть осложнением заражения вашей кошки токсоплазмозом, обратитесь сюда.

Гепатит – это воспаление печени. В может возникнуть внезапно или иметь длительный процесс снижения (хронический). Печень вашего питомца — очень сложный орган, выполняющий множество функций. Он перерабатывает питательные вещества вскоре после того, как они всасываются через кишечник вашего питомца. Одной из его задач является детоксикация соединений, которые были съедены.Именно поэтому он первым соприкасается с токсинами и вредными продуктами, поступающими из пищи вашего питомца. По этой же причине чаще всего этот орган поражается, когда собаки и кошки плохо реагируют на лекарства.

Печень вашего питомца также играет важную роль в обмене веществ, хранении энергии и синтезе белков крови. Он также производит желчь, которая помогает вашему питомцу переваривать пищу. Довольно часто одновременно поражаются как печень, так и желчный пузырь.Печень вашего питомца обладает очень большой резервной емкостью, поэтому она должна быть серьезно повреждена, прежде чем признаки болезни станут очевидными для владельцев домашних животных.

Следующая информация относится к некоторым из наиболее распространенных причин гепатита у собак и кошек – существует гораздо больше, менее частых причин, которые я здесь не обсуждаю. Вы найдете более подробные и подробные обсуждения причин и лечения некоторых из этих форм заболеваний печени по ссылкам в верхней части этой статьи.

Как мой ветеринар может диагностировать заболевание печени у моего питомца?

До тех пор, пока проблемы с печенью не станут достаточно серьезными, признаки заболевания могут быть расплывчатыми и неспецифическими. Они часто сопровождаются потерей веса (хотя в запущенных случаях собаки и кошки на самом деле могут весить больше из-за жидкости, которая скапливается вокруг неисправной печени). При внезапном повреждении печени, таком как прием токсинов, печень часто увеличивается. Увеличенная печень также возникает, когда рак, особенно лимфома, вторгся в орган.Ключом к диагностике заболевания печени у вашей собаки или кошки является измерение уровня ферментов печени, циркулирующих в крови вашего компаньона. Наиболее распространенным ферментом, уровень которого повышается при болезни рычага, является АЛТ. Повышенный уровень АЛТ говорит ветеринару о том, что у вашего питомца повреждена печень, но мало что говорит ему/ей о конкретном повреждении, которое произошло. Другими ферментами, которые часто повышены при гепатите, являются АСТ и ЩФ (щелочная фосфатаза). Метаболит, называемый билирубином, также может быть повышен, а уровень альбумина в крови может быть низким.Вы можете прочитать нормальные значения для этих и других тестов здесь. Если какое-либо из этих соединений подозрительно высоко без объяснения причин, ваш ветеринар, вероятно, проведет ультразвуковое исследование или запросит его. Во время этого осмотра ветеринар, проводящий его, может предложить удалить очень маленький кусочек ткани печени (биопсия) через иглу, направленную в печень под ультразвуковым контролем. По этой биопсии ветеринарный патологоанатом может определить тип присутствующего повреждения печени. Интерпретация патологоанатомом того, что происходит в печени вашего питомца, очень важна для вашего ветеринара при разработке наиболее подходящего плана лечения.

Infectious Canine Hepatitis Of Dogs (Инфекционный гепатит собак,

ИЧ, КАВ-1)

Инфекционный гепатит собак когда-то был первым в списке причин, когда ветеринар подозревал заболевание печени у вашей собаки. Однако эффективные вакцины длительного действия сделали болезнь редкой. Это вызвано вирусом, который является частью группы подобных вирусов, называемых аденовирусами (в данном случае CAV-1). Это заболевание не заразно для людей и кошек, но его могут заразить и переносить также лисы, волки и медведи.Собаки заражаются этой болезнью, вдыхая или проглатывая вирус, если он присутствует в моче, выделениях из носа, глазах и других выделениях инфицированных собак. Собаки могут переносить и передавать вирус в течение года после выздоровления. Собачий аденовирус является частью комбинации вакцин, которую ваш щенок получает в возрасте 12–16 недель. Хотя вирус в вакцине представляет собой собачий аденовирус 2, он также защищает от типа 1. Собачий аденовирус-1 поражает не только печень вашей собаки, его симптомы часто включают кашель, лихорадку, депрессию и отсутствие аппетита, а иногда и неврологические симптомы.(читать здесь)

Попав в кровоток, этот вирус атакует клетки печени, глаз, почек и внутреннюю оболочку кровеносных сосудов по всему телу. К счастью, большинство случаев CAV-1 не так уж серьезны. Домашние животные проявляют немногочисленные, как правило, легкие симптомы и выздоравливают спонтанно. У других собак развивается только кашель. В этих легких формах собаки просто теряют аппетит, ведут себя угрюмо и в течение нескольких дней у них невысокая температура. Но через одну или две недели у некоторых появляется временное синеватое изменение цвета роговицы глаз, называемое «синий глаз».

Считается, что собаки, выздоровевшие от ICH, остаются невосприимчивыми к болезни на всю оставшуюся жизнь (по крайней мере, ни о каком повторном заражении, о котором я знаю, никогда не сообщалось). Но некоторые непривитые щенки серьезно заболевают, когда заражаются инфекционным собачьим гепатитом. У этих щенков может развиться заболевание печени, внутреннее кровотечение, тонзиллит и воспаление рта и глаз. Известно, что эти тяжелые случаи приводили к шоку и смерти.

После проникновения вируса к собаке он локализуется в шейных лимфатических узлах и миндалинах, а затем распространяется по всему телу.Обычно требуется около пяти дней, чтобы инфекция стала очевидной для владельцев. К этому времени симптомы относятся к нахождению вируса в печени, глазах, почках, головном мозге и легких. Зараженные собаки выделяют вирус с калом, слюной и мочой. Течение ICH весьма вариабельно. Как я уже сказал, большинство случаев легкие. Но в течение следующих нескольких недель у некоторых сильно пораженных собак разовьется хронический гепатит и цирроз печени или они даже умрут. У некоторых собак разовьется хроническое заболевание почек (пиелонефрит), глаукома или нарушения кровообращения и свертывания крови (васкулит и ДВС-синдром).

Если собака заразилась вирусом CAV-1, в настоящее время не существует лечения, которое уничтожит вирус. Лучшее, что может сделать ваш ветеринар, — это поддержать собаку хорошим уходом, внутривенными жидкостями, лекарствами и питательными веществами, чтобы облегчить нагрузку на ее печень. Антибиотики обычно также включаются в план лечения для предотвращения вторичных инфекций. Несмотря на то, что Zoetis и другие фармацевтические компании говорят о желательности ежегодных повторных прививок, после вакцинации в возрасте 12 и 16 недель ваша собака будет иметь иммунитет к CAV-1 и CAV-2 в течение многих лет – возможно, на всю жизнь. .Ежегодные ревакцинации не нужны. Читайте об этом здесь. Из-за эффективности этих вакцин случаи собачьего инфекционного гепатита/ICH стали довольно редкими у собак в Соединенных Штатах и ​​Европе.

Лептоспироз

Когда собаки заражаются лептоспирозом, наряду с поражением почек и других органов иногда возникает внезапный гепатит. Читайте о лептоспирозе у собак здесь.

Хронический активный гепатит (ХАГ)

Это заболевание иногда называют хроническим воспалительным заболеванием печени у собак.Хронический активный гепатит чаще встречается у собак, чем у кошек. Это может произойти у любой породы собак, мужчин или женщин. ВГН может возникнуть в любом возрасте, хотя у большинства домашних животных она развивается в среднем и старшем возрасте. Тот факт, что он хронический, означает, что заболевание продолжается в течение нескольких недель или месяцев, в отличие от острых форм гепатита.

При ХАГ постоянное воспаление печени и гибель клеток в конечном итоге приводят к замещению нормальной ткани печени животного рубцовой тканью (цирроз).Во многих случаях точная причина проблемы вашего питомца останется неизвестной.

Некоторые породы предрасположены к CAH, к ним относятся бедлингтон-терьеры, доберман-пинчеры, скай-терьеры, стандартные пудели, кокер-спаниели и вест-хайленд-уайт-терьеры. У многих из этих домашних животных медь содержится в избыточных количествах в печени. Другими заболеваниями, которые могут привести к хроническому активному гепатиту, являются инфекционный гепатит собак, лептоспироз, аутоиммунные заболевания, а также лекарственная и химическая токсичность.Афлатоксины, обнаруженные в заплесневелом зерне (особенно в кукурузе), также могут вызывать это заболевание. Производители высококачественных кормов для домашних животных проверяют зерно, которое они используют, на наличие этих токсинов. Даже беззерновые корма для собак и кошек могут содержать афлатоксины в незерновых источниках углеводов, которые они содержат. Вы можете прочитать о некоторых проблемах, связанных с этими продуктами с высоким содержанием кукурузы, здесь.

Исследование хронического гепатита у английских спрингер-спаниелей в Великобритании показало, что он возникает в более молодом возрасте у представителей этой породы и с большей частотой у сук.Никакой инфекционной причины обнаружить не удалось, и авторы предполагают, что, возможно, многие случаи хронического гепатита у этой породы собак являются формой аутоиммунного заболевания. (читать здесь)

Каковы некоторые признаки хронического активного гепатита?

Симптомы хронического активного гепатита весьма разнообразны, поскольку печень вашего питомца выполняет множество функций. Наиболее распространенными признаками являются повышенная вялость, потеря аппетита и диарея. Эти питомцы часто больше пьют и мочатся.По мере прогрессирования заболевания во многих случаях развивается вздутие живота, наполненное жидкостью (асцит), низкий уровень белка сывороточного альбумина и желтоватые десны, глаза и кожа (= иктеричность, желтушность). В некоторых случаях отказ печени влияет на нервную систему питомца. Они становятся тупыми или кажутся слепыми. О такой форме печеночной недостаточности читайте здесь. Это может прогрессировать до судорог, комы и смерти.

Как диагностируется хронический активный гепатит?

Диагноз основывается на результатах биохимического анализа крови, которые показывают повышение уровня печеночных ферментов, и на результатах биопсии печени, которые показывают аномальную структуру.Физикальное обследование вашей собаки или кошки может предположить заболевание при наличии желтухи; но есть и много непеченочных объяснений желтухи. Печень домашних животных с хроническим активным гепатитом обычно меньше, чем в норме. Это часто можно увидеть на рентгеновских снимках и ультразвуковых изображениях, которые получает ваш ветеринар. Текстура печени, видимая на этих изображениях, также меняется при наличии серьезного цирроза.

Как можно помочь моей собаке и кошке?

Лечение цирроза довольно сложно, потому что у нас пока нет лекарств, стимулирующих регенерацию печени.Госпитализированные собаки обычно получают внутривенные жидкости и общую поддерживающую терапию. Мы часто назначаем им антибиотики, противовоспалительные средства и диеты с низким содержанием белка. Ветеринары продают различные лекарства для «поддержки печени», но ни одно из них не было должным образом проверено на эффективность.

Гепатит, ассоциированный с медью

Хотя медь является важным питательным веществом для вашего питомца, слишком большое ее накопление в печени токсично. Ваша собака или кошка вряд ли будут подвергаться воздействию слишком большого количества меди в пище.Но существуют генетические заболевания, из-за которых в печени питомца накапливается избыток меди. Мы знаем, что эта проблема является иногда наследственным заболеванием у доберман-пинчеров, бедлингтон-терьеров, лабрадоров-ретриверов и далматинцев. (читать здесь и здесь) Конечным результатом является цирроз печени. Для диагностики требуется биопсия печени. Ветеринары пытаются лечить болезнь лекарствами (энтеросорбентами), которые связывают избыток меди и позволяют ее выведению из организма. D-пеницилламин, как правило, является предпочтительным энтеросорбентом наряду с диетами с низким содержанием меди и высоким содержанием цинка.Подробнее об этих специальных диетах читайте здесь. Подобные проблемы с печенью, связанные с метаболизмом меди, были выявлены у Вести и Скай-терьеров.

Гепатит неизвестного происхождения

Даже самые тщательные ветеринары или специалисты по направлениям не всегда могут указать вам причину, по которой у вашей собаки или кошки развилось заболевание печени. Гепатит неизвестного происхождения, идиопатический гепатит или перипортальный гепатит иногда диагностируют у собак и кошек.Когда это происходит, это чаще всего встречается у домашних животных среднего возраста. Все породы и оба пола кажутся одинаково восприимчивыми. Признаки включают рвоту, диарею, потерю веса, желтуху, асцит, депрессию и слабость, а также повышенную жажду и мочеиспускание. Лабораторные тесты обычно показывают увеличение ферментов печени АЛТ и АР, а также увеличение билирубина, желчных кислот и глобулинов и снижение количества альбумина и эритроцитов в крови. Ветеринары лечат эти формы повреждения печени поддерживающей терапией, антибиотиками, диетами с низким содержанием белка и иногда иммунодепрессантами.Как болезнь прогрессирует или разрешается, зависит от количества функциональной ткани печени, которую можно сохранить.

Липидоз печени

Это болезнь кошек. Это происходит, когда ваша кошка не будет есть по разным причинам, связанным со здоровьем или окружающей средой. Вы можете прочитать больше о липидозе печени здесь. Заболевшие кошки часто имеют избыточный вес. Возможно, они перестали есть из-за изменений в своем рационе или из-за стрессовой ситуации дома, например, из-за переезда, содержания в питомнике или проблем со здоровьем у их владельцев.Вторичный липидоз печени также возникает у кошек, страдающих диабетом, кишечными заболеваниями, панкреатитом или любым другим серьезным системным заболеванием. Читайте о панкреатите у вашей кошки здесь. Многие из этих основных состояний попадают в группу, которую я называю триадитом. Вы можете прочитать о триадите/холангиогепатите здесь. Независимо от причины этой проблемы, у всех кошек происходит избыточное накопление триглицеридов (жиров) в печени, что блокирует их нормальную деятельность печени. Признаки этого заболевания включают потерю веса, рвоту, диарею, вялость, слюнотечение и желтуху.Лабораторные тесты часто выявляют повышенные ферменты печени. При лечении этого состояния ветеринары пытаются решить любые основные проблемы со здоровьем, чтобы заставить кошку нормально питаться. До тех пор, пока это не будет сделано, кошек часто необходимо госпитализировать и кормить через зонд высококалорийной пищей.

Вы находитесь на веб-сайте ветеринарии Vetspace

Посещение продуктов, представленных на этом веб-сайте, помогает оплатить стоимость хранения этих статей в Интернете.

Гепатит кошек

Симптомы гепатита чем-то схожи с симптомами другие заболевания печени у кошек. Гепатит – это состояние, которое возникает при у кошки воспаляется печень. Поскольку печень эффективно работает на метаболизировать различные компоненты пищи и детоксицировать кровь, кошки больные гепатитом нуждаются в немедленной медицинской помощи, так как это увеличивает их шанс на выживание.

У большинства кошек симптомы гепатита проявляются, когда заболевание находится в запущенной форме. его запущенная стадия.Однако печень является органом, способным к регенерации. мертвые клетки, и если лечение будет успешным, питомец будет жить несколько лет.

Типы гепатитов и их причины

У кошек обычно встречаются 3 типа гепатита. Эти включают хронический активный гепатит, инфекционный гепатит и лептоспироз. В то время как некоторые домашние животные заражаются гепатитом после входа в контакт с зараженной кровью или фекалиями кошки, у других домашних животных развивается гепатит в результате бактериальной или вирусной инфекции.Некоторые наркотики которые плохо переносятся некоторыми домашними животными, также вызывают гепатит.

Поскольку печень является одним из основных органов, метаболизирующих лекарства, кошкам, страдающим любым заболеванием печени, потребуются лекарства. в небольших количествах, чтобы печень не перегружалась.

Общие симптомы гепатита у кошек включают:

  • Рвота
  • Усталость
  • Желтуха
  • Отсутствие аппетита
  • Диарея
  • Потеря веса
  • Вздутие живота
  • Изменения в поведении
  • Изменение цвета кала (обычно сероватый)
  • Полиурия
  • Полидипсия

Диагностика гепатита у кошек

Ветеринар проведет тщательный медицинский осмотр и пропальпирует кошку. живот, чтобы проверить его на отек.Также будет рентген и УЗИ. проводится для выявления аномалий в брюшной полости. После тщательно оценив проявляемые симптомы, ветеринар проведет серию анализов крови для проверки функции печени.

Кошка также будет проверена на наличие других бактериальных или вирусных инфекций. которые, как известно, вызывают гепатит. Если вы недавно вводили какие-либо новые лекарства для вашей кошки, лучше держать ветеринара в курсе того же поскольку некоторые лекарства вызывают побочные эффекты, которые, в свою очередь, приводят к поражению печени. проблемы.

Лечение гепатита у кошек

Основная цель лечения – уменьшить боль и дискомфорт. что кошка переживает. В большинстве случаев ветеринар назначает кортикостероидные препараты для уменьшения воспаления. Эти препараты имеют вводить точно в соответствии с инструкциями ветеринара, чтобы они не вызывают дополнительного повреждения печени.

Наряду с лекарствами ветеринар может предложить конкретный план диеты для Кот. Большинству кошек, страдающих гепатитом, может помочь рецептурные диеты, такие как Hills Prescription Diet l/d Feline Canned Еда.Если вы предпочитаете давать своему питомцу домашнюю еду, следуйте рекомендациям ветеринара. инструкции по приготовлению пищи, соответствующей диетическим потребностям кошки. Низкий Домашние блюда, приготовленные с содержанием натрия, являются хорошей альтернативой рецептурным диетам.

Если кошка страдает от бактериальной инфекции, ветеринар также назначить курс антибиотиков. Все лекарства должны быть следует вовремя вводить и не допускать передозировки. Кошки выздоравливают от гепатита также могут потребоваться пищевые добавки. Однако лучше всего избегать добавления кошачьего рациона без консультации ветеринара одобрение.

.