Кальцевирусная инфекция у котов: Кальцивирусная инфекция кошек — энциклопедия болезней

Содержание

Кальцивирусная инфекция кошек — энциклопедия болезней

Возбудитель Кальцивироза
Язвы на слизистой оболочке языка

Возбудителем кальцивироза является РНК-содержащий вирус семейства калицивирусы. Обнаружен один серотип, и несколько изолятов с различными антигенными свойствами. Против некоторых из них вакцинация является неэффективной. Многие кошки являются носителями кальцивирусной инфекции (при этом необязательно, если они перенесли это заболевание раннее), и могут заражать восприимчивых кошек. Большинство кошек могут освободиться от вируса в течение нескольких месяцев, и носительство обычно не является пожизненным. Вакцинированные кошки и котята, имеющие материнские антитела, также могут заражаться и становиться носителями (это может быть связано с большим количеством изолятов кальцивироза с различными антигенными свойствами и патогенностью).

Клинические признаки кальцивироза
Язвы на языке

Животные заражают друг друга при взаимном облизывание, игры в одни и те же игрушки. Кальцивирусной инфекции подвержены кошки всех возрастов, однако, чаще болеют котята в возрасте от 2 месяцев до года. От момента заражения до появления первых клинических симптомов проходит обычно 3- 5 суток.

Кальцивирусная инфекция протекает с поражением респираторного тракта. У котенка появляются обильные истечения из глаз, носовой полости, затруднен прием корма (животное может интересоваться кормом, но принимает лишь воду и жидкие корма). Отмечается чиханье, светобоязнь, котенок прячется, становится апатичным, часто регистрируется температура 39, 8-40, 5 (при физиологической норме 38, 0-39, 5), в ротовой полости обнаруживают красные десны, язвочки на языке. Наиболее патогенные штаммы вызывают одышку, кашель, бронхопневмонию. Продолжительность болезни в среднем составляет 7-10 суток.

Диагностика Диагностика кальцивироза затруднена из-за сходства клинических признаков респираторных болезней кошек. Исключают: герпесвирусную инфекцию, хламидиоз, Bordetella bronchiseptica. Для постановки диагноза врачи ветеринарного центра Зоовет берут у кошки смывы из ротовой полости и проводят ПЦР-диагностику.

При тяжелом течение заболевания дополнительно исключают вирусный лейкоз кошек, иммунодефицит кошек, которые также могут давать изъязвление в ротовой полости. Из заболеваний незаразной этиологии исключают уремический гастрит при почечной недостаточности, эозинофильный гастрит.

Лечение

Лечебные мероприятия направлены на активацию иммунного ответа (применяют иммуностимуляторы, витамины), борьбу с вторичной бактериальной инфекцией (антибиотики широкого спектра действия), инфузионная терапия необходима при лихорадке, отсутствие аппетита у больного животного.

Профилактика Вакцинация животных — носителей не устраняет вирус кальцивироза и не предотвращает его выделение. Однако, хорошие условия содержания ваших питомцев, забота о их здоровье и ежегодная вакцинация могут значительно снизить частоту и тяжесть течения заболевания. Лечение

Лечебные мероприятия направлены на активацию иммунного ответа (применяют иммуностимуляторы, витамины), борьбу с вторичной бактериальной инфекцией (антибиотики широкого спектра действия), инфузионная терапия необходима при лихорадке, отсутствие аппетита у больного животного.

Профилактика Вакцинация животных — носителей не устраняет вирус кальцивироза и не предотвращает его выделение. Однако, хорошие условия содержания ваших питомцев, забота о их здоровье и ежегодная вакцинация могут значительно снизить частоту и тяжесть течения заболевания.

Как лечить кальцивироз у собак: помощь ветеринаров клиники Живаго

Абсцесс у кошек, собак

Абсцесс – это ограниченный участок нагноения, который приводит к появлению боли, температуры и слабости. Часто воспалению предшествует проникновение бактерий в рану из окружающей среды или вторично через кровь…

Акне: угри у кошек

Наличие акне у кошек – частое явление, которое может осложниться дерматитом, привести к расчесыванию и нагноению. Если вы заметили у своего питомца угри, желательно посетить врача и сделать соскоб, чтобы исключить опасные инфекции и последующие осложнения…

Актиномикоз кошек

Актиномикоз – заболевание у животных, при котором образуются абсцессы (гнойники) преимущественно на шее или нижней челюсти, которые вызывает грибок из рода актиномицетов…

Асцит у кошек: причины, лечение

Асцит – это скопление большого количества жидкости в брюшинной полости, которая сдавливает внутренние органы и мешает их жизнедеятельности…

Герпес у кошек, собак

Герпес – заболевание острого или хронического течения, которое поражает слизистые оболочки у животных и сопровождается системными проявлениями…

Глаукома у собак, кошек

Глаукома – это заболевание, развивающееся на фоне повышения внутриглазного давления, из-за которого сдавливается сетчатка и мутнеет роговица, появляются местные симптомы…

Демодекоз у кошек, собак

Кошки и собаки часто страдают таким заболеванием, как демодекоз. Его вызывают клещи Demodex, которые поражают кожу питомца, вызывают сильное раздражение и выпадение шерсти…

Дерматит у собак, кошек

Дерматит – распространенное заболевание у кошек и у собак. Его провоцируют расстройства различной природы, из-за которых появляется сильный зуд и раздражение кожи…

Блохи у кошки

Блохи – опасные насекомые, которые питаются кровью зараженного животного. Благодаря сплюснутому тельцу и округлой голове они могут быстро перемещаться даже в густой шерсти, а мощные и длинные задние лапки дают им возможность прыгать на дальние дистанции…

Кальцивироз у кошек

асто у домашних кошек появляется такое неприятное заболевание, как кальцивироз. Это вирусная инфекция верхних дыхательных путей, которая может поражать слизистые оболочки полости рта и характеризоваться системными проявлениями…

Катаракта у кошек

Катаракта – опасное заболевание у кошек, которое может привести к слепоте. Патология характеризуется помутнением капсулы хрусталика и нарушением его преломляющей способности…

Кератит у кошек

Кератит часто встречается у кошек – это поражение роговицы, при котором она мутнеет и перестает нормально функционировать…

Конъюнктивит у кошек

Домашние животные часто страдают конъюнктивитом, заболевание встречается и у кошек. Ему подвержены питомцы в любом возрасте – котята, молодые и взрослые особи…

Гепатит у кошек и собак

Гепатит – это поражение печеночных клеток вирусом, который вызывает их гибель. На месте отмерших гепатоцитов разрастается соединительная ткань, которая не может выполнять утраченные функции…

Гастрит у кошек и собак

Гастрит – это воспаление слизистой желудка, которое возникает под действием микробных агентов или в результате употребления некачественной пищи…

Гемобартонеллез у кошек

Гемобартонеллез – это инфекционное заболевание, сопровождающееся анемией. Его вызывают различные вирусы, которые поражают красные кровяные тельца и вызывают их гибель…

Глисты у кошек, собак

Паразитарные заболевания у домашних животных встречаются довольно часто, особенно если питомец свободно гуляет по улице и контактирует с другими особями…

Лишай у кошек

Многим знакомо такое заболевание у животных, как лишай. Инфекция часто встречается у кошек и характеризуется выпадением кожного покрова вплоть до облысения…

Мозжечковая атаксия кошек

Атаксия – это нарушение координации и произвольных движений. Причиной этого состояния является поражение двигательных нейронов головного мозга …

Запах изо рта у кошки

Если у кошки появился неприятный запах изо рта – стоит задуматься о наличии заболеваний. Он может присутствовать постоянно, появляться утром, в обед или вечером…

Рак кишечника у кошки

Злокачественные опухоли кишечника встречаются редко, но протекают тяжело и дают обширные метастазы. Такие новообразования провоцируют мучительные боли…

Рак крови у кошек

Рак крови или лейкоз – это поражение костного мозга ретровирусом FeLV, в результате чего вырабатываются дефектные…

Рак лёгких у кошек

При таком заболевании в легких возникает первичная опухоль – онкология сопровождается одышкой и слабостью, на фоне которой отмечается…

Хламидиоз у кошек

Хламидиоз – это инфекция, поражающая преимущественно конъюнктиву глаза. Ее вызывает внутриклеточный паразит Chlamydophila psittaci…

Цистит у кошек

При переохлаждении или заражении инфекцией у кошек может развиваться цистит – воспаление слизистой мочевого пузыря…

Энтерит у кошек

Одна из разновидностей инфекционных заболеваний у кошек – энтерит. Это вирусное поражение желудочно-кишечного тракта…

Энцефалит у кошек

Энцефалит – это воспаление оболочек головного мозга, данное заболевание сопровождается общей симптоматикой и проявляется…

Лечение эпилепсии у кошек

Эпилепсия у кошек – опасная патология, которая может серьезно навредить животному. Это неврологическое заболевание…

Язва желудка у кошки

В современных условиях животные страдают от заболеваний пищеварительной системы и язва желудка занимает лидирующие позиции…

Угри у собак

Угри или прыщи у собак – не просто косметический дефект, это воспалительные заболевания кожи…

Актиномикоз у собак

Актиномикоз – опасная инфекция, которая часто развивается у собак. Ее провоцируют лучистые грибки-актиномицеты…

Алопеция у собак

Алопеция – это заболевание, при котором выпадает шерсть до полного облысения. Патологические зоны могут быть…

Вывести блох у собаки

Блохи – распространенная неприятность у собак. Кровососущие не только доставляют дискомфорт, но и передают опасных паразитов, которыми животное может заболеть уже при первом укусе…

Кальцивироз у собак

Кальцивироз – патология, которой могут болеть даже домашние собаки, получающие должное внимание от хозяев…

Лечение кератита у собаки

Кератит – заболевание, при котором появляются язвы на роговице, в результате чего отмечается раздражение и воспалительная реакция…

Лечение конъюнктивита у собак

Воспаление конъюнктивы – частая проблема у собак. Эта оболочка выстилает наружную поверхность склеры и глазницу изнутри, формируя…

Ожирение у собак

Лишний вес может доставить серьезные неприятности домашним питомцам, включая осложнения заболеваний сердечно-сосудистой систем и опорно-двигательного…

Панкреатит у собак

Панкреатит – это воспаление поджелудочной железы с развитием клинических признаков, из которых самым выраженным является боль…

Панлейкопения у собак

Панлейкопения – опасное смертельное вирусное заболевание у собак, которое в первую очередь поражает желудочно-кишечный тракт…

Паротит у собаки

Паротит – это воспаление слюнных желез, при котором нарушается процесс жевания и глотания, клиника сопровождается болью и расстройством…

Перикардит у собак

Перикардит – это воспаление околосердечной сумки и опасное заболевание, которое характеризуется тяжелой клиникой…

Пиелонефрит у собак

Пиелонефрит – воспалительное заболевание почек с поражением чашечно-лоханочной системы…

Плеврит у собак

Плеврит – это воспаление плевры, оболочки, покрывающей легкие снаружи и грудную клетку изнутри…

Пневмония у собак

Пневмония или воспаление легких – часто встречающееся заболевание у собак, особенно в холодное время года…

Рак челюсти у собак

Рак челюсти – это злокачественная опухоль, склонная к разрастанию и к повреждению окружающих тканей…

Рак груди у собак

Рак груди у собак – опасная патология, которая чаще встречается у сук…

Рак лёгких у собак

Новообразования дыхательной системы считаются одними из самых опасных…

Рак крови у собак

Рак крови или лейкоз – опасная патология у собак, которая часто приводит к гибели животного…

Рак кишечника у собаки

Злокачественные новообразования занимают первые места среди патологий с высокой смертностью у животных…

Ринит у собаки

Ринит – распространенное заболевание верхних дыхательных путей….

Ринотрахеит у собак

Ринотрахеит – простудное заболевание верхних дыхательных путей, которое чаще всего появляется…

Себорея у собак

Себорея – распространенное кожное заболевание у собак, которое может спровоцировать осложнения…

Токсоплазмоз у собак

Токсоплазмоз – тяжелое заболевание, которое вызывает внутриклеточные паразиты Toxoplasma gondii…

Трихофития у собак

Кожные заболевания у собак относятся к одним из самых распространенных, среди них часто встречается трихофития…

Угри у кошек

Наличие угрей у кошек хозяева не сразу замечают, принимая их за перхоть или обычную грязь…

Уретрит у собаки

Болезни мочеполовой системы у животных часто вызывают местные инфекции, среди таких патологий выделяют уретрит…

Фарингит у собак

Фарингит – это воспаление гортани, при котором отекает слизистая оболочка и появляются местные симптомы…

ФИП у собак

ФИП (FIP) – вирусное поражение брюшины (перитонит), которое провоцирует возбудитель из семейства коронавирусов…

Флегмона у собаки

Иногда у питомцев развиваются гнойные процессы, среди которых часто встречается флегмона…

Фурункулёз у собак

Фурункулез – заболевание, характеризующееся появлением на коже волдырей и признаков раздражения…

Хламидиоз у собак

Среди всех инфекций у собак хламидиоз является одной из самых опасных – при этой патологии встречаются системные поражения…

Цистит у собак

Среди всех заболеваний мочеполовой системы цистит у собак встречается довольно часто – это воспаление слизистой оболочки мочевого пузыря…

Экзема у собаки

Собаки в силу своей активности и насыщенной жизни подвержены заболеваниям кожи, среди которых встречается экзема…

Энтерит у собаки

Энтерит – это воспаление тонкого кишечника с расстройством его функции…

Энцефалит у собаки

Из всех заболеваний центральной нервной системы энцефалит считается одним из самых опасных и сопровождается тяжелыми осложнениями…

Эпилепсия у собаки

Эпилепсия – неврологическое заболевание, характеризующееся возникновением очага возбуждения в головном мозге, который…

Язва желудка у собаки

Язва желудка – распространенное заболевание у домашних питомцев, от него страдают и собаки…

Ампутация конечностей собаки

Для лечения некоторых серьезных заболеваний рекомендована ампутация конечностей – если ее делает профессиональная ветеринарная служба…

Кальцевирусная инфекция у кошек: лечение, симптомы, причины

Высокой степенью заразности отличается кальцевирусная инфекция у кошек. Вирус не передается человеку, поэтому хозяевам не стоит опасаться заражения. Наиболее остро болезнь проявляется у котят и может привести к их гибели, если патологию своевременно не лечить. Распознать заболевание удается по лихорадочному состоянию питомца, у которого повышается температура до 40 градусов. При активности вируса кот становится вялый, кашляет и часто чихает, отказывается от приема пищи. Кошачья кальцивирусная инфекция требует незамедлительного обращения к ветеринару, который подберет необходимую терапию.

Главные причины

Впервые определил вирус FCV (Feline calicivirus), провоцирующий кальцивироз у кошек, Фостьер — американский ветеринар. В легких домашнего животного были обнаружены кальцинаты и в 1957 году было доказано инвазивность кальцивирусной инфекции.

После попадания инфекции в организм питомца, период инкубации до появления первых симптомов длится около 3 суток. В большей степени подвержены заболеванию молодые особи, которые имеют слабую иммунную систему. Заражение FCV у котов происходит следующим образом:

  • Обнюхивание зараженных фекалий.
  • Валяние в траве, в которой имеются уринарные выделения переносчика кальцивирусной инфекции.
  • Воздушно-капельный путь. Поскольку радиус действия вируса ограниченный и составляет не более 1 м, но все же стоит подальше держаться от зараженных котов и кошек.
  • Заражение от человека. Последний может быть переносчиком патологии, при этом активность вируса сохраняется 2—3 суток.
  • Передача кальцивироза посредством любых кошачьих выделений.
Вернуться к оглавлению

Основные симптомы: как распознать болезнь?

Характерной особенностью болезни считаются язвы в пасти животного.

Вирусная инфекция такого типа развивается достаточно быстро и сопровождается ярко выраженной симптоматикой, поэтому не заметить развития патологии хозяева не могут. Калицивироз проявляется, как правило, на 2 сутки после заражения. В первую очередь клинические признаки возникают в ротовой полости кошек, человек может обнаружить небольшие ранки во рту, которые поражают глубокие слои. Сперва возникают мелкие пузыри величиной до 1 мм, которые локализуются на боковой части языка и твердом небе. В дальнейшем ранами покрывается не только весь рот домашнего животного, но кальцивирусная инфекция переходит на ноздри. При лопании пузырьков появляются эрозии и язвочки, доставляющие сильную боль.

Длительность кальцевирусной инфекции у котов составляет от 7 дней до месяца. На 2 неделю ранки проходят и происходит заживление слизистой оболочки полости рта и других органов. Поскольку на миндалинах вирус может оставаться дольше, то даже после выздоровления кошка считается заразной и может передать заболевание другому питомцу. Распознать кальцивирусную инфекцию удается по таким симптомам:

  • повышенная температура — до 40 градусов и выше;
  • чихание и кашель;
  • выделения серозного типа из глаз и носовой полости;
  • формирование ороговевшей корки вокруг рта;
  • одышка, не связанная с нагрузками;
  • болевой синдром в суставах и мускулатуре, вследствие чего кот может прихрамывать при ходьбе;
  • угнетенное состояние;
  • отказ от корма.

Калицивироз легко распространяется на лимфатические узлы и миндалины питомца, а при запущенном течении затрагивает легочную ткань, вследствие чего развивается трахеит, бронхит либо пневмония.

Вернуться к оглавлению

Способы диагностики

Исследовав кровь питомца, можно определить причину его болезни.

Схема лечения кальцевирусной инфекции подбирается индивидуально для каждого кота после проведения комплексного обследования. В домашних условиях определить возбудителя невозможно, из-за чего любое самостоятельное лечение будет неэффективным. При заболевании стоит обратиться к ветеринару, который осмотрит кота. Определить недуг удается посредством лабораторной диагностики, включающей такие исследования:

  • анализ крови;
  • полимеразная цепная реакция (ПЦР).

Поскольку симптомы кальцевирусной инфекции схожи с признаками других вирусных заболеваний, то стоит провести дифференциальную диагностику. С похожими симптомами протекает аденовирус, герпесвирусная инфекция у кошек, хламидиоз. При неправильной постановке диагноза вылечить калицивироз проблематично, поскольку лекарства не воздействуют на возбудителя патологии, а лишь оказывают симптоматическую терапию и через время болезнь повторяется.

Вернуться к оглавлению

Необходимое лечение

При подозрении на кальцевирусную инфекцию у котов требуется обращаться к ветеринару. Чем раньше будет определено заболевание, тем легче от него избавиться и предупредить развитие осложнений. Больному питомцу требуется обеспечить хороший уход и покой. Основу терапии составляет подбор правильного питания. Поскольку при заболевании повреждается в большей степени слизистая оболочка ротовой полости домашнего животного, то требуется давать еду мягкой консистенции, чтобы дополнительно не травмировать. Лучше кормить кота мясным бульоном, а от сухого корма отказаться до выздоровления.

Антибиотикотерапия может осуществляться препаратом Флемоксин.

После того, как будут определены причины развития кальцевирусной инфекции, ветеринар подберет необходимые медикаменты. Лекарства не только оказывают симптоматическое действие, но и подавляют активность патогенных микроорганизмов. Против кашля при кальцевирусной инфекции коту прописывают отхаркивающие препараты. Также в лечении используются другие лекарства, указанные в таблице.

Медикаментозная группаНазвание
Антибиотики с широким спектром воздействия«Кобактан»
«Кламоксил»
«Амоксициллин»
«Флемоксин»
Сульфаниламиды«Триметосульф»
«Сульф 120»
Лекарства, улучшающие иммунную систему«Фоспренил»
«Иммунофан»
Витаминные комплексы«Гамавит»
«Цеосорб витамин плюс»

При запущенном течении кальцевирусной инфекции могут вводить в организм питомца кальций и другие необходимые микроэлементы с помощью инъекций, которые выполняет исключительно ветеринар.

Вернуться к оглавлению

Вероятные осложнения

Если болезнь дала осложнения на головной мозг животного, то унего появится судорожный синдром.

Если у животного обнаружен кальцинат, то стоит обращаться к врачу как можно скорее. Чем раньше начать лечение кальцевирусной инфекции, тем меньше вероятности негативных последствий. Запущенная форма патологии тяжелее поддается терапевтическим действиям. Наибольшую опасность болезнь несет для молодых и ослабленных особей, у которых иммунная система не в состоянии противостоять патогенным микроорганизмам. У котят нередко симптоматика проявляется не так ярко в первое время, из-за чего лечение не начинают вовремя. При регулярной рвоте и поносе, организм питомца быстро обезвоживается. На фоне кальцевирусной инфекции у котов возникают следующие осложнения:

  • пневмония;
  • сильные хрипы в легких;
  • ларингит;
  • трахеит;
  • признаки анемии;
  • поражение головного мозга, вследствие чего фиксируются судороги;
  • летальный исход, наступающий через несколько дней после осложнений.
Вернуться к оглавлению

Передается ли человеку?

Оптимальный вариант лечения животного – оформление его в сационар при ветеринарной клинике.

Калицивирусная инфекция не представляет угрозы для человеческого здоровья и жизни, но при этом патология может передаваться от питомца. В таком случае человек становится переносчиком инфекции, а симптоматика болезни проявляется в редких случаях, лишь при существенно сниженных резистентных свойствах организма. При уходе за больным животным требуется следить за правилами гигиеничности и соблюдать меры безопасности. Чтобы не рисковать собственным здоровьем, лучше сделать коту прививку от инфекции, и не допускать нахождение питомца с другими животными, особенно, обитающими на улице. Особенно важно следовать профилактическим мерам детям, у которых организм может быть менее устойчивый к разного рода инфекциям. Лучше проводить лечение кота в стационаре ветеринарной клиники.

Вернуться к оглавлению

Прогноз и профилактика

Аденовироз, калицивироз и другие инфекционные патологии представляют опасность для домашних животных и без своевременной помощи ветеринаров грозят негативными последствиями. Если болезнь диагностирована у котенка, то в большинстве случаев она приводит к гибели спустя 2—3 недели после инфицирования. У взрослых особей летальных исход возможен при осложнениях. Предупредить кальцевирусную инфекцию у кошек возможно с помощью вакцинации. Часто используются такие вакцины, как «Мультифен», «Феловакс-4», «Нобивак-Трикант» и другие препараты. Рекомендуется следить за питанием питомца и поддерживать чистоту в доме. Вовремя проведенная дегельминтизации помогает избежать патологии.

Кальцевирусная инфекция у кошек сколько лечится

Калицивирусная (не правильное написание кальцевирусная) инфекция у кошек – распространенное заболевание, возбудителем которого является РНК-содержащий вирус.

Наиболее восприимчив к патологии молодняк возрастом от 1 месяца до 2 лет. При отсутствии адекватного лечения болезнь переходит в хроническую форму, что негативно отражается на здоровье домашнего питомца.

Как происходит заражение?

В большей степени патологии подвержены уличные кошки

Заражение домашнего питомца происходит при контакте с больным животным, совместных играх, облизывании шерсти, через поилки и кормушки.

Возбудитель (кальцевирусной) инфекции выделяется со слюной, глазным секретом, фекалиями и мочой на протяжении нескольких месяцев. Чаще всего вирус проявляет активность в зимний период.

В сухой среде возбудитель калицивироза сохраняет свою жизнеспособность на протяжении 2-3 дней, а во влажной – в течение 10 дней.

В большей степени патологии подвержены уличные кошки, а у домашних питомцев вирус проявляется редко.

Какие органы и системы поражает вирус калицивироза у кошек?

Калицивироз поражает верхние дыхательные пути питомца, слизистую оболочку рта, глаз, негативно влияет на суставы, что провоцирует развитие артрита.

Калицивироз поражает верхние дыхательные пути питомца, слизистую оболочку рта, глаз, негативно влияет на суставы

При проникновении возбудителя в организм первые признаки появляются на слизистой ротовой полости в виде полусферических пузырьков с гладкой поверхностью и четко ограниченными границами. Их диаметр составляет 5-10 мм. Пузырьки локализуются на верхней и боковых частях языка, на средней линии неба, а также снаружи ноздрей.

В течение нескольких дней наросты созревают, лопаются и превращаются в эрозии. При отсутствии терапии они продолжают углубляться в слизистую оболочку. В течение 2 недель язвы зарастают, а поверхностный слой регенерирует.

При отсутствии лечения вирус распространяется вглубь, что вызывает воспаление легких и бронхов. А также были зафиксированы случаи поражения оболочки головного мозга, что может спровоцировать гибель животного.

Как проявляется болезнь?

Клицивирусная (кальцевирусная) инфекция у кошек

Распознать калицивирусную (кальцевирусную) инфекцию у кошек можно по характерным признакам. Внимательное отношение к своему питомцу поможет выявить заболевание в начальной стадии поражения.

Основные симптомы:

  • значительное повышение температуры до 40 градусов, которая не спадает на протяжении 3 дней;
  • обильное слюноотделение и выделение секрета из носа, что можно распознать по мокрой шерсти на подбородке;
  • водянистые нарывы на слизистой рта;
  • лающий сухой кашель;
  • угнетенное состояние;
  • отсутствие интереса к еде;
  • воспаление десен;
  • неприятный запах изо рта;
  • затруднительное дыхание с присутствием булькающих звуков;
  • регулярное чихание.

При проникновении вируса в оболочку головного мозга у домашнего питомца появляются судороги конечностей, беспричинное чувство страха, шаткая походка, приступы агрессии.

Животные с повышенным иммунитетом легко переносят заболевание с незначительными патологическими признаками, а у ослабленных кошек калицивироз развивается в тяжелой форме и может спровоцировать летальный исход.

Чем опасна калицивирусная (

кальцевирусная)инфекция для котят?

Наиболее опасна патология для котят, так как их иммунная система полноценно не сформировалась и не способна противостоять внедрению патогена.

Поражение на носу верхней губы у взрослого кота на фоне калицивирусной инфекции, заболевание развилось после того, как владельцы подобали на улице молодого, внешне здорового котенка

Опасность вируса в том, что у котят клинические признаки не проявляются в полной мере, и это затрудняет диагностику. В большинстве случаев они схожи с симптомами ларингита, трахеита и пневмонии, а анализ крови показывает анемию. Выявить калицивироз помогает только диагностирование язвенного глоссита.

Характерные симптомы у котят:

  • апатия;
  • вялость;
  • понос;
  • рвота;
  • отказ от еды;
  • светобоязнь.

Несвоевременно начатое лечение может стать причиной летального исхода. В случае заражения беременной кошки уровень смертности новорожденных котят составляет 84-90% всех диагностируемых случаев.

Передается ли болезнь человеку

Калицивироз неопасен для человека, поэтому при лечении больного питомца дополнительные меры защиты не требуются. Также он не передается другим животным, так как данной инфекции подвержены только представители кошачьих.

Препараты для лечения кальцивироза у кошек

Калицивироз неопасен для человека

Для подавления активности вируса и искоренения его из организма ветеринар назначает лечение в зависимости от возраста животного, стадии развития и формы патологии.

Основные виды препаратов:

  1. Средства, снижающие негативные симптомы, помогающие облегчить самочувствие питомца.
  2. Антибиотики, подавляющие активность и распространение вируса: Амоксициллин, Флемоксин, Кобактан.
  3. Противобактериальные средства: Триметосульф, Сульф 120.
  4. Средства, повышающие иммунитет: Фоспренил, Иммунофан.
  5. Внутривенные инъекции для предотвращения обезвоживания: раствор глюкозы, растворы Ринтера-Локка.
  6. Витаминные комплексные препараты: мультивитамины, Гамавит.
  7. Отхаркивающие средства, улучшающие отход слизи.

При лечении также применяются наружные антисептические средства для обработки язв в ротовой полости и носовых пазухах. Наиболее эффективные препараты: Дентаведин, Йодинол. Обработку рекомендуется проводить каждые 2 часа.

Для промывания глаз рекомендуется использовать Ципровет, Максидин. При этом стоит набраться терпения, так как больное животное агрессивно реагирует на любую лечебную процедуру.

Использовать препараты без назначения ветеринара крайне опасно, даже если присутствуют все характерные признаки инфекции. Терапию следует проводить только после подтверждения диагноза врачом согласно утвержденной им дозировки и схемы приема.

Уход за больным животным и профилактика

Чтобы питомец быстрее пошел на поправку, следует в первую очередь сбалансировать его питание, отдавая предпочтение легкоусваиваемым продуктам.

Но так как больное животное не проявляет интереса к еде, то нужно использовать жидкую пищу, разбавляя паштеты, каши, пюре молоком или бульоном. Вводить еду следует с помощью шприца без иглы, часто и небольшими порциями.

Необходимо также следить за чистотой подстилки и инвентаря, чтобы исключить вероятность вторичного инфицирования.

Профилактические меры для исключения вероятности заражения:

  • проводить вакцинацию в двухмесячном возрасте с последующей ежегодной ревакцинацией;
  • ограничить контакт домашнего питомца с уличными животными;
  • верхнюю одежду и обувь убирать в шкаф сразу после прихода домой, чтобы животное не соприкасалось с вещами;
  • регулярно менять подстилку и мыть весь инвентарь питомца;
  • тщательно мыть руки после контакта с чужой кошкой.

Заключение

Внимательное отношение к своей кошке поможет уберечь животное от калицивироза.

При появлении тревожных признаков следует вызвать ветеринара, так как любое промедление может привести к серьезным осложнениям для здоровья.

Передаётся ли калицивирусная инфекция кошек человеку?

 

Многих людей беспокоит вопрос, можно ли заразиться калицивирозом, ухаживая за заболевшей кошкой или котёнком? Вопрос не праздный, ведь основной уход за больным питомцем ложиться на владельца, и ему придётся промывать воспалённые глаза, чистить выделения из носа, обрабатывать язвы в полости рта, делать инъекции.

Как заражаются кошки?

Калицивирусная инфекция весьма распространена, протекает с неприятными симптомами и особо опасна для котят и молодых животных в возрасте от 1 месяца до двух лет. При неблагоприятных условиях в 30% случаев заболевание может вызывать гибель животного. Чаще всего люди сталкиваются с калицивирозом у своих кошек, если выпускают не вакцинированных животных на улицу или при появлении в доме нового питомца, являющегося носителем заболевания.

Помните, признаки внешнего благополучия животного не гарантируют безопасность других кошек при контакте с ним, ведь переболевшая кошка выделяет вирус в окружающую среду ещё несколько месяцев после болезни!

 

Кошки передают инфекцию друг другу воздушно-капельным и алиментарным путём (при совместном пользовании лотками, мисками для воды и корма, лежанками), а также через слюну, выделения из носа и глаз при вылизывании друг друга. Самому владельцу волноваться не нужно: калицивирусная инфекция кошек не передаётся человеку. Собаки тоже не болеют калицивирозом, хотя некоторые исследования показывают, что очень похожие вирусы были у них выделены.

Правила гигиены при калицивирусной ннфекции кошек

Несмотря на то, что вирус не опасен для людей, при уходе за больным питомцем следует изолировать его на время лечения в отдельное помещение от детей, других кошек и собак, а также соблюдать элементарные меры гигиены:

  • проводить обработку больного животного в перчатках;
  • мыть и обрабатывать дезинфектором руки после обработки животного, уборки лотка, мытья мисок;
  • уничтожать использованные салфетки и тампоны;
  • протирать поверхности дезинфекторами;
  • дезинфицировать использованные инструменты;
  • при порезах и царапинах вымыть руки, обработать и закрыть раны.

Современная ветеринария успешно лечит калицивирусную инфекцию у кошек приблизительно за две недели, и в большинстве случаев справляется даже с тяжёлыми формами, но рассчитывать на благоприятный прогноз можно только при своевременном обращении в клинику и неукоснительное выполнение назначений врача.

 

Научно-исследовательская работа — Docsity

МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ федеральное государственное бюджетное образовательное учреждение высшего образования «Курская государственная сельскохозяйственная академия имени И.И.Иванова» Факультет ветеринарной медицины Специальность 36.05.01 Ветеринария Профиль «Ветеринария» Форма обучения заочная Кафедра: эпизоотологии, радиобиологии и фармакологии НИР «Кальцивирусная инфекция кошек» Выполнил(а): студентка 6 курса группы ЗФ-ВН151 __________ ___________ А.А. Макарова (дата) (подпись) (расшифровка подписи) Проверил: руководитель работы _ ____________ _________ _____ В.И. Еременко (должность) (оценка) (дата) (подпись) (расшифровка подписи) КУРСК – 2020 Содержание Введение……………………………………………………………………………3 1. Характеристика возбудителя болезни………………………………………….5 2. Характеристика клинических признаков болезни………………………….6 3. Диагностика кальцивирусной инфекции кошек…………………………….8 4. Дифференциальная диагностика кальцивирусной инфекции кошек…….10 5. Лечебные мероприятия……………………………………………………..12 6. Профилактические мероприятия…………………………………………..18 Выводы……………………………………………………………………………………………………. Список использованной литературы………………………………………….21 2 1. Характеристика возбудителя болезни. Кальцивирусная инфекция кошек (feline calicivirus infection, calicivirosis) — возбудитель инфекции вирус. [18]. Вирус впервые выделил и описал Фостьер в 1957 году в США. Возбудитель — РНК — вирус семейства Caliciviridae, рода Calicivirus. Эти вирусы имеют чашевидную вдавленность на своей поверхности, от чего и пошло название «кальцивирус» (от лат. сalices — чашка), что и послужило названием для всего семейства Caliciviridaе. Это простоорганизованный РНК — геномный вирус, имеет форму икосаэдра, диаметром 30-40 нм, кубической симметрии, без оболочки. Вирус репродуцируется в цитоплазме культуры клеток почки или языка котят, где уже через 24 — 36 часов развиваются характерное ЦПД и формируются тельца-включения [9]. Вирус сравнительно устойчив к теплу, изменениям рН, эфиру и хлороформу. Вирус имеют относительно короткий срок существования во внешней среде, он может прожить до 1 недели или чуть дольше, если окружающая среда влажная. Существует ряд различных штаммов кальцивируса кошек, которые могут отличаться как по антигенности, так и по патогенности. Однако большинство штаммов, обследованных до настоящего времени, довольно тесно связанны между собой и, возможно, составляют один серотип. [22]. Размножение вируса происходит в основном в ротовой полости и тканях верхних дыхательных путей, однако некоторые штаммы имеют очевидную предрасположенность к размножению в легких. Иногда вирус обнаруживается в висцеральных тканях, испражнениях и даже в моче, вирусный антиген был определен внутри макрофагов в суставах, однако значимость этой находки в патогенезе синдрома хромоты, иногда 5 наблюдаемого после инфекционного заболевания, вызванного кальцивирусом, остается неизвестной. [19] При поражении вирусом эпителия слизистой оболочки ротовой полости вначале на ней образуются гладкие полусферические, четко отграниченные пузырьки диаметром 5-10 мм. Пузырьки появляются главным образом в области верхней и боковых поверхностей языка, на твердом нёбе по обе стороны от его средней линии, а также вне ротовой полости — на наружных частях ноздрей. Пузырьки вскоре лопаются. На их месте образуются эрозии, которые могут углубляться и изъязвляться, что чаще отмечают на слизистой оболочке твердого нёба, особенно у кошек, питающихся сухим кормом. В течение 2х недель слизистая оболочка в местах эрозий регенерирует. Особенно активное размножение кальцивируса происходит в эпителиальных клетках крипт миндалин, которые под его действием подвергаются дистрофии и некрозу [11]. Одним из достоверных методов идентификации вируса является прямая визуализация самого вируса, но низкая чувствительность является самым большим ограничением электронного метода как диагностического средства. [7] 6 2. Характеристика клинических признаков болезни Начало кальцивироза как у взрослых кошек, так и у котят внезапное. Анорексия (отказ от пищи). Гипертермия (температура повышается до 40 градусов по Цельсию). Характерными признаками кальцивирусной инфекции так же являются: изъязвления в полости рта, истечения из носа и глаз, незначительная лихорадка, чихание, возможно хромота. Одышка, частое дыхание при пневмонии. При постановке диагноза следует исключить хламидиоз и герпесвирусную инфекцию кошек, так как чаще всего при всех трех инфекциях наблюдается конъюнктивит, выделение из носа и чихание. Отличительными и характерными симптомами кальцивируса могут быть: язвы в ротовой полости, первичная пневмония и хромота [22]. В начале болезни отмечают отказ от корма, исхудание, бледность слизистых оболочек. В основном болезнь характеризуется поражением верхних дыхательных путей. Первичные признаки болезни — носовые и глазные выделения серозного характера, чихание, кашель. У больных отмечают серозный конъюнктивит, ринит, одышку, лихорадку, признаки пневмонии, изъязвление слизистой оболочки языка, неба, ноздрей. Важный признак — обильная саливация. На переднем крае и спинке языка, твердого или мягкого неба, наружной поверхности ноздрей вначале появляются пузырьки, быстро переходящие в язвы. Могут так же место иметь отдышка и другие симптомы, связанные с пневмонией у кошек [9,22]. Так же известны штаммы вируса, вызывающие специфические клинические проявления болезни. Например, штамм FCV — 255 поражает только респираторный тракт; известен пневмотропный штамм вируса, вызывающий только некротические поражения в легких и язвенный 7 Одним из достоверных методов идентификации вируса является прямая визуализация самого вируса, но низкая чувствительность является самым большим ограничением электронного метода как диагностического средства [3]. Для выявления кальцивируса можно так же использовать вирусологический метод. Выделение кальцивируса в культуре клеток хорошее, но это очень трудоемкая и дорогостоящая процедура, почти не используемая в ветеринарной практике. Вирус выделяют в субкультурах или перевиваемых культурах клеток почки кошек. Для выделения вируса используют монослой культуры клеток почек котенка. Время культивирования составляет 48-72 ч. По истечении этого срока пластины с инфицированными культурами клеток замораживают и оттаивают, а полученную культуральную жидкость исследуют под электронным микроскопом. Для идентификации вируса в лабораторных условиях можно использовать метод биопробы. Так же хорошим методом является реакция нейтрализации (РН). Для этого метода используются стандартные сыворотки. РН ставят общепринятым методом в культуре клеток. Результаты РН учитывают по ЦПД вируса. Серологические методы часто имеют ограниченное значение, для диагностики кальцивирусной инфекций, поэтому обычно бесполезны, так как многие кошки либо вакцинированы, либо переболели в прошлом [19]. Основными методами для диагностики кальцивирусной инфекции в ветеринарных лечебницах является гематологическое исследование, при котором выявляют лимфопению и снижения уровня гемоглобина на 25-30% и решающее значение придается иммунологическим тестам [28]. 10 4. Дифференциальная диагностика кальцивирусной инфекции кошек. Постановка диагноза на кальцивироз затрудняется в связи со схожестью симптомов заболевания с другими инфекциями – герпесвирусом, хламидиозом и др. Дифференциальная диагностика проводиться в случае осложненного протекания кальцивироза. Необходимо отличить ее от вирусной лейкемии, иммунодефицита, гепаторенальной недостаточности и эозинофильного гастрита. Клинические симптомы похожи на признаки следующих заболеваний:  Ринотрахеит (Герпесвирус).  Хламидиоз. Общими для Ринотрахеита и Калицивироза считают следующие симптомы:  Конъюнктивит.  Насморк.  Пневмония. Различия наблюдают по следующим признакам:  Обильное слюнотечение характерно только для Калицивирусной инфекции.  Язвенные стоматиты — признаки Кальцивироза.  Кератиты с изъязвлением роговицы характерны для Ринотрахетиа.  Кашель наблюдают при герпесвирусной инфекции. Для Кальцивироза он не является отличительным признаком.  Хромота не характерна для Ринотрахеита. Общими для Хламидиоза и Калицивироза считают следующие симптомы: 11  Бронхит или пневмония.  Хромота.  Насморк.  Потеря аппетита. Различия наблюдают по следующим признакам:  Обильное слюнотечение, не характерно для Хламидиоза  Язвенные стоматиты — симптом Калицивирусной инфекции.  Блефароспазм и третье веко наблюдают при Хламидиозе. При герпесе характерны воспаление роговицы глаза с изъязвлением, кашель. Нет стоматита, язв в ротовой полости, слюнотечения, хромоты. При хламидиозе отмечают спазм века, выход третьего века на ггаз. Нет слюнотечения и язв в ротовой полости. При бешенстве есть признаки поражения головного мозга (изменение поведения, припадки, судороги). Нет язв во рту, насморка. Панлейкопения (чума кошек) протекает с болями в животе, рвотой, сильно понижаются лейкоциты в крови. Рисунок 1. Истечения из носа и глаз 5. Лечебные мероприятия. 12  Риботан.  Фосфпренил.  Иммунофан.  Катозал.  Максидин. Рисунок 3. Кошке поставили капельницу Десенсибилизация. Существует необходимость предотвращения потери жидкости, а также солей, ответственных за поддержание в норме осмотического давления. Остро стоит проблема удаления из крови токсичных продуктов жизнедеятельности микроорганизмов и распавшихся клеток. С этой целью, внутривенно, преимущественно капельно, вводят детоксикационные смеси:  Реополиглюкин.  Растворы Рингера, Хартмана, Рингер-Локка.  Сорбилакт.  Раствор глюкозы 5%. 15 Симптоматическая терапия. Для устранения симптомов заболевания применяют специфические средства:  Противовоспалительные анальгетики. При возникновении артритов востребованы следующие препараты: 1. Кетофен. 2. Стоп-артрит. 3. Римадил и пр. Все медикаменты применяемые для устранения боли в суставах у кошек небезопасны, поэтому должны контролироваться ветеринарным врачом.  Средства санации пасти. Орошают ротовую полость антисептическими растворами, преимущественно, препаратами, содержащими Хлоргексидин или Фурацилин. Для скорейшего заживления дефектов применяют Винилин или раствор Люголя с глицерином.  Препараты для лечения конъюнктивита. Востребованы капли для промывания глаз. Прежде чем закапывать лекарство, необходимо зафиксировать кошку, чтобы не быть оцарапанным, удалить экссудат, промокнув его марлевой или бумажной салфеткой и закапать лекарство. Процедуру проводит владелец кота насколько раз в сутки. Хорошим врачевательным эффектом обладают глазные мази, например, тетрациклиновая. Её можно наносить реже, чем капли. 16 Рисунок 4. Экссудат удаляют из глаз салфеткой Общеукрепляющие препараты. Борьба с инфекциями истощает запасы витаминов. Востребованы комплексные лекарства, являющиеся источником микроэлементов, аминокислот, прочих компонентов питания. Поскольку большинство патологий протекает с нарушением алиментарных функций, используют инъекционные формы лекарств. Хорошо зарекомендовали себя следующие препараты:  Гамавит .  Аминовит.  Мультивит.  Ультравит. Уход за больной кошкой. Сухие корма временно заменяют влажными: при язвенном стоматите кошке трудно пережёвывать и глотать пищу. Уход за котом нельзя прекращать при улучшении состояния. Все предписания ветеринарного врача 17 3. Нобивак Forcat. Голландия. Вакцина против калицивироза, вирусного ринотрахеита, панлейкопении и хламидиоза кошек живая сухая, с растворителем. Вакцинации подлежат клинически здоровые кошки, с 8-9 недельного возраста. Если необходима более ранняя защита, допускается применение вакцины в 6-ти недельном возрасте. Затем животное должно быть вакцинировано повторно в 8-9 и в 12 недель. 4. Мультифел НПО «Интервет»Нарвак», Мультифел-2, Россия: панлейкопения, ринотрахеит и кальцивирус. Мультифел — 3, Россия: панлейкопения, ринотрахеит, кальцивирус и хламидиоз кошек. Мультифел- 4, Россия: панлейкопения, ринотрахеит, кальцивирус, хламидиоз. Прививать котят можно с 2-х месячного возраста. Вакцину вводят подкожно в дозе 1 мл. При использовании вакцины «Мультифел-3» с профилактической целью, котят первый раз прививают в 8-12 — недельном возрасте и повторно через 21-28 дней. Ревакцинацию проводят в возрасте 10-12 месяцев. Взрослых кошек иммунизируют ежегодно. Иммунитет наступает через 14 дней и сохраняется в течение года. 5. Вакцины серии «Интервет»Пуревакс». «Интервет»Мериал», Франция. Трехвалентная «Пуревакс RCP» и четырехвалентная «Пуревакс RCPCh»» и четырехвалентная «Пуревакс RCP» и четырехвалентная «Пуревакс RCPCh»Ch»» (против панлейкопении, инфекционного ринотрахеита, калицивирусной инфекции и хламидиоза кошек). Содержат инактивированный компонент кальцивируса. Иммунитет к заражению кальцивирозом вырабатывается через 14 дней после второго введения вакцины, сроком на один год. 6. Феловакс (Fel-O-Vax)), США: панлейкопения, вирусная лейкемия кошек, ринотрахеит, кальцивирус, хламидиоз. Вакцину вводят 1мл здоровым котятам в возрасте от 8 недель, через 3 — 4 недели вакцинируют повторно той же дозой. Взрослых невакцинированных животных рекомендуется вакцинировать дважды по 1 мл вакцины с интервалом 3 — 4 недели. Ревакцинировать кошек ежегодно [9,26]. 20 Вакцинировать можно только здоровых животных. Перед прививкой проводят дегельминтизацию. Перед вязкой рекомендуется привить кошку за 3 – 4 недели для обеспечения высокого уровня материнских антител у будущего потомства. Беременных кошек прививать нельзя. Кроме вакцинации соблюдают общие правила профилактики инфекционных болезней.  Полноценное кормление.  Гигиена содержания: регулярная влажная уборка (при групповом содержании – регулярная дезинфекция), соблюдение зоогигиенических параметров воздуха (вентиляция, температура, влажность).  При групповом содержании вновь поступивших животных содержат отдельно в течение 10-14 дней (карантин).  Владельцу кошки не рекомендуется посещать дома, где есть заболевшие питомцы. Если это невозможно, то после возвращения переодеваются, тщательно моют руки с мылом, не дают кошке контактировать с уличной одеждой и обувью. Кальцивирусная инфекция в большинстве случаев заканчивается благополучно. Тяжелее переносят болезнь маленькие котята и ослабленные животные. В любом случае при первых признаках инфекции – чихание, насморк, слюнотечение, отказ от корма – кошку нужно показать ветеринарному врачу. Он назначит лечение, которое обычно осуществляется на дому. Чтобы защитить кошку от кальцивирусной инфекции рекомендуется своевременно делать прививки. 21 Заключение Кальцивирус на сегодняшний день является частой причиной возникновения инфекционных респираторных болезней кошек [9]. Частоту возникновения этой инфекционной болезни можно объяснить нарушениями условий содержания домашних кошек: несоблюдением гигиенических мероприятий, несвоевременной или неэффективной вакцинацией и безнадзорным выгулом животных. В нашем случае анализ клинических признаков, диагностики и профилактики калицивироза, позволил получить следующие результаты: Заболевание регистрируется у животных разных возрастных групп. Чаще всего кальцивироз диагностируют у котят до 6 месяцев, и у кошек от 6 месяцев до 2 лет. Распространение кальцивируса среди молодых животных предположительно происходит из-за слабого иммунитета и отсутствия приобретенного иммунитета [3]. Изучая клиническое проявление инфекционной болезни, которая характеризуется поражением респираторного тракта, у больных отмечают серозный конъюнктивит, ринит, одышку, лихорадку, чихание, кашель. Важный признак — обильная саливация, запах изо рта. На переднем крае и спинке языка язвы [9,22]. Большинство штаммов, обследованных до настоящего времени, довольно тесно связанны между собой и хотя в клиническом плане существует приемлемый уровень перекрестной защиты между большинством из этих разновидностей, кошки могут последовательно заразиться одним из этих штаммов, это приводит чаще всего к бесконтрольному заражению животных [18,22]. Анализ лечебных мероприятий показал, что они направлены на восстановление защитного барьера слизистой оболочки, борьбу с вирусами, 22 Нижнегородской государственной сельскохозяйственной академии. — Нижний Новгород: НГСХА, 2015. — Вып.1. — С.56-58. 11. Гришковская, Е.В. Патоморфология калицивироза кошек: афтореф. дис. канд. ветеринарных наук по спец.16.00.02. — СПб.: Институт ветеринарной биологии, 2005. — 91с. 12. Данилевская, И.В. Общая ветеринарная рецептура: учеб. пособие для вузов/ И.В. Данилевская, С.Н. Преображенский, Л.П. Парасюк [и др.]. — М.: ФГБОУ МГАВМиБ им.К.И. Скрябина, 2012. — 6с. 13. Демберт Дж. Карлсон, Джеймс М. Гиффин, Лиза Д. Карлсон/Домашний ветеринарный справочник для владельцев кошек/Пер. с англ. Л. А. Стукалиной. — «Рекомендации лучших специалистов» — М.: ЗАО Изд-во Центрполиграф, 2002.- 574с. 14. Зелютков, Ю.Г. Инфекционные болезни кошек: учеб. пособие для вузов/ Ю.Г. Зелютков, В.А. Машеро, В.В. Петров. — Витебск: УО ВГАВМ, 2003. — 59с. 15. Комарова, Г.В. Болезни кошек/ Г.В. Комарова. — М.: АСТ, 2005. — 63с. .Конопаткин, А.А. Эпизоотология и инфекционные болезни сельскохозяйственных животных/ А.А. Конопаткин, И.А. Бакулов, Я.В. Нуйкин. — М.: Колос, 1984. — 544с. 16. Ларина, О.В. Новейший справочник ветеринара/ О.В. Ларина. — М.: ООО Дом Славянской Книги, 2012. — 800с. 17. Макаров, В.В. Учение об инфекции и иммунитете: учеб. пособие для вузов/ В.В. Макаров. — М.: Российский университет дружбы народов, 2008. — 142с. 25 18. Матвеева К.И., М.И.Соколов. Руководство по микробиологической диагностики инфекционных болезней. «Медицина» Москва 1994.- 38с. 19. Никитин, И.Н. Ветеринарное предпринимательство/ И.Н. Никитин, И.М. Восилевский. — М.: Колос, 2001. — 264с. 20. Орлов, Ф.М. Словарь ветеринарных клинических терминов/ Ф.М. Орлов. — М.: Россельхохиздат, 1983. — 336с. 21. Пархоменко, С.А. Эффективность применения Фелиферона в составе комплексной терапии панлейкопении кошек/ С.А. Пархоменко, О.А. Зейналов // Journal of Small Animal P» и четырехвалентная «Пуревакс RCPCh»ractice. — М.: Логос Пресс, 2015. — №5. — С.57-58. 22. Прудников, В.С. Патоморфологическая диагностика малоизученных и тропических болезней животных/ В.С. Прудников, Б.Я. Бирман, И.А. Анисим. — Витебск: УО ВГАВМ, 2007. — 131с. 23. Рахманина, М.М. Особенности проявления кальцивирусной инфекции кошек, вызванной разными штаммами вируса // М.М. Рахманина, В.И. Уласов // Ветеринарная патология. — М.: Ветеринарный консультант, 2006. — №3. — С.22-26. 24. Рахманина М.М., Элизбарашвили Э.И., Уласов В.И., Могильный Ю.И. Калицивироз кошек // Ветеринария N 9, 1994.- 51с. 25. Рахманина М.М., Элизбарашвили Э.И., Уласов В.И., Мо гильный Ю.И. Выделение и идентификация возбудителей калицивироза и инфекционного ринотрахеита кошек // сборник научных трудов ВГНКИ. том 57. Москва 1995. – 28с. 26. Рэмси, Я. Инфекционные болезни собак и кошек. Практическое руководство/ Я. Рэмси, Б. Теннант. — М.: Аквариум Принт, 2005. — 312с. 26 27. Сидорчук, А.А. Общая эпизоотология: учеб. издание для вузов/ А.А. Сидорчук, Е.С. Воронин, А.А. Глушков. — М.: КолосС, 2004. — 165с. 28. Сюрин В.Н., Самуйленко А.Я. Соловьев Б.В., Фомина Н.В. Вирусные болезни животных/ Москва: ВНИИТИБП, 2002.- 16с. 29. Сергеев В.А., Орлянкин Б.Г., Гусев А.А., Сухарев О.И. Ветеринарная вирусология/: учебное пособие// Москва- Владимир: ОАО «Серпуховская бумажная фабрика», 2001.- 40с. 30. Справочник ветеринарного врача/ А.Ф Кузнецов. — Москва: «Лань», 2002. — 896с. 31. Справочник ветеринарного врача/Сост. и общ. ред. В.Г. Гавриша, И.И, Калюжного. Изд-е 4-е, испр. И доп. — Ростов н/Д: изд-во «Фенмкс», 2003.-576с. (Серия «Медицина для вас») 32. Справочник ветеринарного врача/ П.П. Достоевский, Н.А. Судаков, В.А. Атамась и др. — К.: Урожай, 1990. — 784с. 33. Трофимова, Е.Н. Экономическая эффективность профилактических и противоэпизоотических мероприятий при болезнях собак и кошек/ Е.Н. Трофимова/ Ученные записки Казанской государственной академии ветеринарной медицины им. Н.Э. Баумана. — Казань: КГАВМ, 2012. — №1. — С.211-216. 34. Чандлер, Э.А. Болезни кошек/ Э.А. Чандлер, К. Дж. Гаскелл, Р.М. Гаскелл. — М.: Аквариум Принт, 2011. — 688с. Электронные ресурсы. 35. Кальцивироз у кошек. Симптомы, схемы лечения, профилактика кальцивироза. [Электронный ресурс]: Режим доступа: h»ttp://animal.jofo.ru/239238.h»tml. 27

чем лечится и сколько, опасна ли для человека

Калицивирусная (не правильное написание кальцевирусная) инфекция у кошек — распространенное заболевание, возбудителем которого является РНК-содержащий вирус.

Наиболее восприимчив к патологии молодняк возрастом от 1 месяца до 2 лет. При отсутствии адекватного лечения болезнь переходит в хроническую форму, что негативно отражается на здоровье домашнего питомца.

Как происходит заражение?

В большей степени патологии подвержены уличные кошки

Заражение домашнего питомца происходит при контакте с больным животным, совместных играх, облизывании шерсти, через поилки и кормушки.

Возбудитель (кальцевирусной) инфекции выделяется со слюной, глазным секретом, фекалиями и мочой на протяжении нескольких месяцев. Чаще всего вирус проявляет активность в зимний период.

В сухой среде возбудитель калицивироза сохраняет свою жизнеспособность на протяжении 2-3 дней, а во влажной — в течение 10 дней.

В большей степени патологии подвержены уличные кошки, а у домашних питомцев вирус проявляется редко.

Какие органы и системы поражает вирус калицивироза у кошек?

Калицивироз поражает верхние дыхательные пути питомца, слизистую оболочку рта, глаз, негативно влияет на суставы, что провоцирует развитие артрита.

Калицивироз поражает верхние дыхательные пути питомца, слизистую оболочку рта, глаз, негативно влияет на суставы

При проникновении возбудителя в организм первые признаки появляются на слизистой ротовой полости в виде полусферических пузырьков с гладкой поверхностью и четко ограниченными границами. Их диаметр составляет 5-10 мм. Пузырьки локализуются на верхней и боковых частях языка, на средней линии неба, а также снаружи ноздрей.

В течение нескольких дней наросты созревают, лопаются и превращаются в эрозии. При отсутствии терапии они продолжают углубляться в слизистую оболочку. В течение 2 недель язвы зарастают, а поверхностный слой регенерирует.

При отсутствии лечения вирус распространяется вглубь, что вызывает воспаление легких и бронхов. А также были зафиксированы случаи поражения оболочки головного мозга, что может спровоцировать гибель животного.

Как проявляется болезнь?

Клицивирусная (кальцевирусная) инфекция у кошек

Распознать калицивирусную (кальцевирусную) инфекцию у кошек можно по характерным признакам. Внимательное отношение к своему питомцу поможет выявить заболевание в начальной стадии поражения.

Основные симптомы:

  • значительное повышение температуры до 40 градусов, которая не спадает на протяжении 3 дней;
  • обильное слюноотделение и выделение секрета из носа, что можно распознать по мокрой шерсти на подбородке;
  • водянистые нарывы на слизистой рта;
  • лающий сухой кашель;
  • угнетенное состояние;
  • отсутствие интереса к еде;
  • воспаление десен;
  • неприятный запах изо рта;
  • затруднительное дыхание с присутствием булькающих звуков;
  • регулярное чихание.

При проникновении вируса в оболочку головного мозга у домашнего питомца появляются судороги конечностей, беспричинное чувство страха, шаткая походка, приступы агрессии.

Животные с повышенным иммунитетом легко переносят заболевание с незначительными патологическими признаками, а у ослабленных кошек калицивироз развивается в тяжелой форме и может спровоцировать летальный исход.

Чем опасна калицивирусная (

кальцевирусная)инфекция для котят?

Наиболее опасна патология для котят, так как их иммунная система полноценно не сформировалась и не способна противостоять внедрению патогена.

Поражение на носу верхней губы у взрослого кота на фоне калицивирусной инфекции, заболевание развилось после того, как владельцы подобали на улице молодого, внешне здорового котенка

Опасность вируса в том, что у котят клинические признаки не проявляются в полной мере, и это затрудняет диагностику. В большинстве случаев они схожи с симптомами ларингита, трахеита и пневмонии, а анализ крови показывает анемию. Выявить калицивироз помогает только диагностирование язвенного глоссита.

Характерные симптомы у котят:

  • апатия;
  • вялость;
  • понос;
  • рвота;
  • отказ от еды;
  • светобоязнь.

Несвоевременно начатое лечение может стать причиной летального исхода. В случае заражения беременной кошки уровень смертности новорожденных котят составляет 84-90% всех диагностируемых случаев.

Передается ли болезнь человеку

Калицивироз неопасен для человека, поэтому при лечении больного питомца дополнительные меры защиты не требуются. Также он не передается другим животным, так как данной инфекции подвержены только представители кошачьих.

Препараты для лечения кальцивироза у кошек

Калицивироз неопасен для человека

Для подавления активности вируса и искоренения его из организма ветеринар назначает лечение в зависимости от возраста животного, стадии развития и формы патологии.

Основные виды препаратов:

  1. Средства, снижающие негативные симптомы, помогающие облегчить самочувствие питомца.
  2. Антибиотики, подавляющие активность и распространение вируса: Амоксициллин, Флемоксин, Кобактан.
  3. Противобактериальные средства: Триметосульф, Сульф 120.
  4. Средства, повышающие иммунитет: Фоспренил, Иммунофан.
  5. Внутривенные инъекции для предотвращения обезвоживания: раствор глюкозы, растворы Ринтера-Локка.
  6. Витаминные комплексные препараты: мультивитамины, Гамавит.
  7. Отхаркивающие средства, улучшающие отход слизи.

При лечении также применяются наружные антисептические средства для обработки язв в ротовой полости и носовых пазухах. Наиболее эффективные препараты: Дентаведин, Йодинол. Обработку рекомендуется проводить каждые 2 часа.

Для промывания глаз рекомендуется использовать Ципровет, Максидин. При этом стоит набраться терпения, так как больное животное агрессивно реагирует на любую лечебную процедуру.

Использовать препараты без назначения ветеринара крайне опасно, даже если присутствуют все характерные признаки инфекции. Терапию следует проводить только после подтверждения диагноза врачом согласно утвержденной им дозировки и схемы приема.

Уход за больным животным и профилактика

Чтобы питомец быстрее пошел на поправку, следует в первую очередь сбалансировать его питание, отдавая предпочтение легкоусваиваемым продуктам.

Но так как больное животное не проявляет интереса к еде, то нужно использовать жидкую пищу, разбавляя паштеты, каши, пюре молоком или бульоном. Вводить еду следует с помощью шприца без иглы, часто и небольшими порциями.

Необходимо также следить за чистотой подстилки и инвентаря, чтобы исключить вероятность вторичного инфицирования.

Профилактические меры для исключения вероятности заражения:

  • проводить вакцинацию в двухмесячном возрасте с последующей ежегодной ревакцинацией;
  • ограничить контакт домашнего питомца с уличными животными;
  • верхнюю одежду и обувь убирать в шкаф сразу после прихода домой, чтобы животное не соприкасалось с вещами;
  • регулярно менять подстилку и мыть весь инвентарь питомца;
  • тщательно мыть руки после контакта с чужой кошкой.

Заключение

Внимательное отношение к своей кошке поможет уберечь животное от калицивироза.

При появлении тревожных признаков следует вызвать ветеринара, так как любое промедление может привести к серьезным осложнениям для здоровья.

Кошачий калицивирус – MyPeterinarian

Кошки могут быть поражены широким спектром различных вирусов и бактерий. Одним из наиболее распространенных является кошачий калицивирус. Этот вирус имеет тенденцию вызывать симптомы со стороны верхних дыхательных путей и может быть обнаружен как у домашних кошек, так и у их диких сородичей.

Что такое кошачий калицивирус?

Калицивирус кошек — это вирусная инфекция, которая обычно возникает в районах с высокой плотностью населения, таких как приюты для животных или крупные заводчики кошек.Вирус может способствовать заболеваниям полости рта, таким как тяжелые инфекции полости рта и боль, а также респираторным заболеваниям.

В отличие от некоторых других вирусов, вызывающих симптомы со стороны верхних дыхательных путей у кошек, кошачий калицивирус может вызывать изъязвления во рту вашей кошки. Они могут возникать на языке и деснах, а также на носу. Как вы, вероятно, можете себе представить, они, как правило, невероятно болезненны. Вы можете заметить, что у вашей кошки слюноотделение или проблемы с жеванием. Даже роняют еду, когда пытаются достать корм из миски.

У кошек с активной инфекцией также могут быть выделения из глаз или носа, сопровождающиеся воспалением розовых тканей вокруг глаз (конъюнктивит) и чиханием. В то время как у некоторых кошек выделения прозрачные, у других могут появиться более густые слизистые выделения. Особенно, если у них развивается вторичная бактериальная инфекция поверх вируса.

Более того, существует множество различных штаммов этого вируса, и вы можете наблюдать различные симптомы. Они могут включать вялость, лихорадку и даже желтуху.К сожалению, один штамм особенно склонен вызывать широко распространенные заболевания и оказывается очень заразным и смертельным. По данным VCA Animal Hospitals, необходимо срочное лечение.

Кошачий калицивирус наиболее распространен среди котят, хотя он может развиться у любой кошки. Вирус распространяется в основном через выделения, например, из глаз и носа. Он может даже выживать на поверхностях в течение нескольких дней. После заражения кошки могут проявлять признаки болезни в течение нескольких недель, и все это время они заразны.Однако некоторые из них остаются заразными в течение длительного периода времени.

Ваш ветеринар может диагностировать кошачий калицивирус у вашей кошки только на основании имеющихся у нее симптомов. Особенно, если у них есть респираторные признаки и изъязвления в полости рта. Если необходим точный диагноз, ваш ветеринар может взять образцы конъюнктивы вашей кошки или задней части горла и отправить их в лабораторию для тестирования.

Лечение кошачьего калицивируса

Ваш ветеринар может дать различные рекомендации по лечению вашей кошки с калицивирусом.Поскольку у многих из этих кошек болезненный рот или проблемы с обонянием, они часто не хотят есть. Возможно, вам придется попробовать высококалорийные продукты, такие как Hill’s a/d, или даже тщательно подогретое детское питание. Вашей кошке может потребоваться введение жидкости внутривенно или под кожу, чтобы избежать обезвоживания.

Могут потребоваться некоторые лекарства. Например, противовоспалительные препараты, такие как Онсиор или мелоксикам, особенно если у вашей кошки высокая температура или хромота из-за вируса.

Хотя вы можете подумать, что антибиотики необходимы, ваш ветеринар, скорее всего, не назначит их.Если только они не видят признаков, которые могут быть связаны с бактериальной инфекцией, осложняющей вирусную инфекцию. Это помогает предотвратить устойчивость к антибиотикам из-за неправильного использования антибиотиков.

Многим кошкам с конъюнктивитом ветеринарный врач может прописать лекарства для глаз, чтобы уменьшить воспаление или инфекцию, от противовирусных капель до мазей с антибиотиками.

Владельцы домашних животных могут быть очень расстроены, когда их кошка чувствует себя плохо. Тем не менее, вы можете помочь им почувствовать себя немного лучше.Пропарьте ванную комнату, приняв горячий душ, и приведите кошку в комнату на несколько минут, чтобы уменьшить заложенность дыхательных путей. Протирание глаз и носа вашей кошки чистой влажной тканью также может уменьшить местное раздражение.

Вакцинация против калицивируса кошек и профилактика инфекции

Вы можете помочь защитить свою кошку от кошачьего калицивируса, отведя ее к ветеринару для получения основных вакцин. В дополнение к вакцинации против бешенства большинству кошек помогает вакцинация против комплекса вирусов, как, например, вакцина FVRCP.Котятам и невакцинированным кошкам необходимо проводить ревакцинацию соответствующим образом в первый год, а затем в соответствии с рекомендуемым графиком, чаще всего ежегодно или каждые три года.

Также важно ограничить контакт вашей кошки с другими кошками. Содержание кошек в помещении снижает риск заражения вирусными инфекциями, а также защищает их от других проблем, таких как укусы животных или попадание под машину.

Если в доме заболела одна кошка, обязательно тщательно продезинфицируйте бытовые поверхности, посуду, постельное белье и игрушки.Держите больных кошек изолированными, пока они не осмотрятся ветеринаром, и мойте руки между контактами с домашними животными, чтобы свести к минимуму риск передачи инфекции.

Вкратце

Любая кошка может заболеть кошачьим калицивирусом, а некоторые штаммы особенно заразны. Хорошей новостью является то, что вы можете снизить риск для своей кошки, сделав ей прививку у ветеринара. Если вы заметили, что ваша кошка плохо себя чувствует, обратитесь к врачу для осмотра и следуйте рекомендациям по лечению, чтобы сократить продолжительность болезни.

Кошачий калицивирус: часто задаваемые вопросы

Кошки могут болеть многими из тех же видов вирусных и бактериальных инфекций, что и их владельцы-люди. Однако некоторые заболевания представляют опасность, специфичную для этих животных. Одно из таких заболеваний, известное как кошачий калицивирус (FCV), может вызывать как неприятные симптомы, так и потенциально серьезные осложнения.

Как заинтересованный владелец кошки, вы захотите узнать все, что возможно, о факторах риска, симптомах и осложнениях FCV, а также о любых диагностических, лечебных и профилактических мерах, которые могут восстановить и сохранить здоровье вашего любимца из семейства кошачьих.Ознакомьтесь с этими часто задаваемыми вопросами о кошачьем калицивирусе и ответами на них.

Почему кошки заражаются кошачьим калицивирусом?

Хотя микроб, вызывающий кошачий калицивирус (представитель Семейство вирусов Caliciviridae) не представляет угрозы для человека, чрезвычайно легко распространяется среди кошек. По этой причине кошки, которые проводят время в питомниках, приютах для животных, пансионах и других местах, где проживает несколько кошек, имеют повышенный риск заражения.

Даже если смотрители такой среды позаботятся о дезинфекции пространства, следы FCV могут оставаться на поверхностях, представляя риск заражения других кошек в будущем.Эта угроза заболевания может сохраняться до один месяц. Кроме того, человек, контактировавший с зараженной кошкой, может передать заболевание здоровой кошке.

Какие симптомы и осложнения может вызывать кошачий калицивирус?

В случае кошачьего калицивируса может пройти до 14 дней, прежде чем появятся симптомы. Когда эти симптомы, наконец, появляются, они могут сначала напоминать симптомы сильной простуды. Например, у вашей кошки может появиться насморк, выделения из глаз, потеря аппетита и легкая лихорадка. В глазах могут быть признаки конъюнктивита (конъюнктивита).

Вирус также проявляет другие симптомы, более специфичные для FCV. Ищите такие признаки, как хромота, язвы во рту или на языке, слюнотечение, проблемы с дыханием (осложнение, связанное с пневмонией) и высокая температура. Желтуха или отек лица и ног могут означать, что болезнь повредила внутренние органы вашей кошки.

Калицивирус кошек обычно протекает в три недели. Тем не менее, многие кошки будут продолжать переносить вирус в течение нескольких месяцев или даже до конца своей жизни, что делает их потенциальной угрозой инфекции для своих собратьев-кошек.

Как ветеринары лечат кошачий калицивирус?

Ваш ветеринар может сказать вам, есть ли у вашей кошки кошачий калицивирус. Язвы во рту и на языке, в дополнение к другим внешним симптомам, могут оказаться достаточными для постановки диагноза. Чтобы подтвердить этот диагноз, ветеринар может исследовать образцы тканей и выделений и подвергнуть их лабораторным исследованиям.

В настоящее время в ветеринарной медицине отсутствует противовирусный препарат, который мог бы остановить распространение FCV. Вместо этого ваш ветеринар сосредоточится на мерах по контролю симптомов и осложнений.Например, если у вашей кошки в качестве осложнения развилась пневмония, антибиотики могут помочь укротить пневмонию и восстановить нормальное дыхание.

Другие поддерживающие методы лечения могут помочь вашей кошке чувствовать себя и лучше функционировать в течение недель, которые могут потребоваться для исчезновения инфекции. Примеры включают лекарства для облегчения боли в суставах, глазные капли для лечения конъюнктивита и, в тяжелых случаях, зонд для кормления, чтобы помочь кошкам с болезненными язвами во рту получать питание.

Как защитить кошку от калицивируса?



Самая мощная индивидуальная профилактическая мера против кошачьего калицивируса включает вакцинацию против этой болезни.Ветеринары обычно включают эту вакцину в основные прививки, рекомендуемые для всех кошек. Если вы соблюдаете основной график вакцинации своей кошки, ваша кошка уже пользуется этой защитой.

К сожалению, поскольку FCV может принимать множество вариаций и мутаций, ни одна вакцина не может обеспечить полную защиту от болезни. Однако, даже если ваша вакцинированная кошка действительно заразится FCV, у нее должны быть гораздо менее серьезные симптомы и осложнения, чем без этой защиты.

Ветеринарная клиника Альта Виста обладает опытом, навыками, инструментами и сострадательным подходом, в которых нуждается ваша кошка, независимо от того, страдает ли она вирусом лихорадки или какой-либо другой неприятной инфекцией. Свяжитесь с нашим офисом сегодня, чтобы запланировать обследование, лечение или любые необходимые профилактические прививки.

Исследователь удваивает ставку на смертельные инфекционные болезни кошек — ScienceDaily

Если бы у кошек действительно было девять жизней, одна из причин могла бы заключаться в том, чтобы помочь справиться с широким спектром болезней, которые угрожают кошачьему здоровью.

Юнчжон Ким, доцент Колледжа ветеринарной медицины Канзасского государственного университета, разработал исследовательский подход, позволяющий одновременно бороться с двумя смертельными инфекционными заболеваниями кошек. Ее работа поддерживается премией в размере 156 342 долларов от Фонда животных Морриса.

«Коронавирусные и калицивирусные инфекции очень распространены среди кошек, и кошки, как правило, неоднократно заражаются этими вирусами на протяжении всей своей жизни», — сказал Ким, который работает в отделении диагностической медицины и патобиологии колледжа.«Кошачий коронавирус может вызывать гастроэнтерит, а калицивирус часто вызывает язвенную инфекцию верхних дыхательных путей с гингивитом и стоматитом. В большинстве случаев эти вирусные инфекции протекают легко и проходят самостоятельно».

Но Ким говорит, что у некоторых кошек, зараженных этими вирусами, развиваются опасные для жизни заболевания с высокой летальностью. Смертельная форма кошачьей коронавирусной инфекции, кошачий инфекционный перитонит или FIP, была признана с начала 1970-х годов и в настоящее время является основной инфекционной причиной смерти молодых кошек.Совсем недавно появилась вирулентная системная калицивирусная инфекция кошек, или FCV, связанная с системной инфекцией, которая часто приводит к летальному исходу. С 1998 года в приютах для животных и питомниках были зарегистрированы многочисленные вспышки инфекции, вызванной FCV, смертность достигала 67 процентов.

Доступны вакцины против FIP и FCV, но их применение в полевых условиях ограничено или не рекомендуется по разным причинам, а противовирусных препаратов для этих вирусных инфекций не существует. Это означает, что существует большая потребность в безопасных и эффективных противовирусных препаратах для лечения этих заболеваний.

«Мы работаем над вирусной протеазой, которая высоко консервативна среди некоторых вирусов, включая коронавирус и калицивирус, — сказал Ким. «Эта вирусная протеаза, 3C-подобная протеаза, необходима для успешной репликации вируса, поэтому она является многообещающей мишенью для разработки противовирусных препаратов».

Ким сотрудничает с Кён-Ок Чангом из Университета штата Канзас, вирусологом отдела диагностической медицины и патобиологии, а также с Дуй Хуа и Уильямом Гроутасом, медицинскими химиками из Университета штата Канзас и Университета штата Уичито соответственно.

«Мы разработали серию ингибиторов 3C-подобной протеазы и определили пару многообещающих соединений на различных этапах, включающих изучение взаимосвязи между структурой соединения и его биологической активностью, — сказал Ким. «Некоторые работы были поддержаны другим грантом Winn Feline Foundation. Соединения, эффективные против вируса FIP, в настоящее время исследуются на предмет фармакокинетических свойств у кошек в сотрудничестве с доктором Нильсом С. Педерсеном из Калифорнийского университета в Дэвисе.Это даст нам ценную информацию, которая поможет нам в дальнейших усилиях по разработке безопасного и эффективного противовирусного препарата для лечения FIP».

Ким продолжает исследовать возможность разработки противовирусных соединений, которые активны как против FIPV, так и против FCV. Процесс открытия и разработки лекарств очень долгий и дорогой и может быть сопряжен с трудностями.

«Все больше и больше внимания уделяется разработке противовирусных препаратов широкого спектра действия, которые действуют против многих вирусов, — сказал Ким.«Вот почему мы также создали серию соединений с широкой активностью против FIP и против FCV на основе структурного и функционального сходства протеаз этих вирусов. В течение следующих трех лет при поддержке гранта Morris Animal Foundation мы будет характеризовать эти соединения по свойствам, подобным лекарствам, а также определить дополнительные резервные соединения.Помимо ингибиторов протеазы, мы идентифицировали клеточный фермент, который важен как для FIPV, так и для FCV.Грант также поддержит наше исследование роли клеточного фермента в репликации вируса, что может дать важную информацию о патогенности этих вирусов, а также может привести к новой мишени для противовирусных препаратов.»

Проблема, по словам Кима, заключается в том, что противовирусный препарат должен быть не только эффективным для уменьшения клинических симптомов и смертности, но также должен быть безопасным и, желательно, доступным для приема внутрь.

«Сейчас мы находимся на ранней стадии, и нам предстоит преодолеть много препятствий», — сказала она. «Но нас воодушевляет прогресс, которого мы добиваемся на пути к цели».

Кошачий калицивирус | Ветеринарные исследования, журнал по инфекциям животных

Вет. Рез.38 (2007) 319-335
DOI: 10.1051/vetres:2006056

Калицивирус кошек

Алан Д. Рэдфорд, Карен П. Койн, Сьюзан Доусон, Кэрол Дж. Портер и Розалинд М. Гаскелл

Ливерпульский ветеринарный университет Hospital, Leahurst, Chester High Road, Neston, S. Wirral, CH64 7TE, United Kingdom

(Получено 23 июня 2006 г.; принято 25 сентября 2006 г.; опубликовано онлайн 13 февраля 2007 г.) является важным и широко распространенным возбудителем кошки.Он принадлежит к семейству Caliciviridae , которое включает другие важные патогены. человека и животных. Как РНК-вирус, высокая частота ошибок полимеразы передается на FCV обладает высокой пластичностью генома и позволяет вирусу быстро реагировать на давления отбора окружающей среды. Это делает вирус очень адаптируемым и имеет важное значение для клинического заболевания и контроля над ним. Существование генетически разнообразный, FCV связан с рядом клинических синдромов от неявных инфекций до относительно легких инфекций полости рта и верхних дыхательных путей заболевания тракта с острой хромотой или без нее.В последнее время высоко вирулентный появились формы вируса, связанные с системной инфекцией, часто со смертельным исходом. Доля кошек, инфицированных FCV, выздоравливающих после острого болезнь, остаются персистентно инфицированными. У таких кошек эволюция вируса считается, что помогает вирусу уклониться от иммунного ответа хозяина. Такой долгосрочный носители могут представлять лишь меньшинство кошачьей популяции, но вероятно, имеет решающее значение для эпидемиологии вируса. Вакцинация против FCV был доступен в течение многих лет и эффективно снизил частота клинических проявлений заболевания.Однако вакцины не предотвращают инфекция, а вакцинированные кошки все еще могут заразиться хронически. В Кроме того, изменчивость штаммов FCV означает, что не все штаммы защищены против поровну. Большой прогресс был достигнут в понимании биологии. и патогенез этого важного кошачьего вируса. Проблемы на будущее обязательно сосредоточится на том, как контролировать изменчивость этого вируса особенно в отношении возникающих вирулентных штаммов и вакцинации.


Ключевые слова: калицивирус / эволюция / кошачьи / вакцинация / вирулентность

Автор, ответственный за переписку: аланрад@лив.ac.uk

© INRA, EDP Sciences, 2007

Идентификация кошачьего интерферон-регуляторного фактора 1 как эффективного противовирусного фактора против репликации кошачьего калицивируса и других кошачьих вирусов

Интерфероны (ИФН) могут подавлять большинство, если не все, гены (ISG). Калицивирус кошек (FCV) является высококонтагиозным патогеном кошек и суррогатом вируса Norwalk.Интерферон эффективно ингибирует репликацию FCV, но механизм противовирусной активности изучен недостаточно. Здесь мы оценили анти-FCV-активность десяти ISG, о противовирусной активности которых сообщалось ранее. Результаты показали, что регуляторный фактор интерферона 1 (IRF1) может значительно ингибировать репликацию FCV, тогда как другие ISG, протестированные в этом исследовании, оказались неэффективными. Кроме того, мы обнаружили, что IRF1 был локализован в ядре и эффективно активировал IFN- β и промотор ISRE.IRF1 может запускать продукцию эндогенного интерферона и экспрессию ISG, предполагая, что IRF1 может положительно регулировать передачу сигналов IFN. Важно отметить, что уровни мРНК и белка IRF1 были снижены при инфицировании FCV, что может быть новой стратегией уклонения FCV от врожденной иммунной системы. Наконец, была продемонстрирована противовирусная активность IRF1 в отношении вируса панлейкопении кошек, вируса герпеса кошек и вируса инфекционного перитонита кошек. Эти данные показывают, что кошачий IRF1 играет важную роль в регуляции ответа IFN I типа хозяина и ингибировании кошачьих вирусных инфекций.

1. Введение

Калицивирус кошек (FCV) является высококонтагиозным патогеном кошек и обычно вызывает легкие или серьезные заболевания полости рта и верхних дыхательных путей [1]. FCV принадлежит к Vesivirus, роду Caliciviridae, который включает малые РНК-содержащие вирусы, имеющие как медицинское, так и ветеринарное значение [2]. Норовирусы человека (HuNoV) и многие другие калицивирусы трудно культивировать in vitro, а отсутствие моделей инфекции in vitro и надежных моделей на мелких животных создает препятствия для разработки вирус-специфических методов лечения и профилактических вакцин [3].Хотя недавние исследования показали, что ограниченная репликация HuNoV может происходить в иммортализованных В-клетках [4, 5], это не может быть идеальной клеточной моделью для изучения характеристик HuNoV. Поскольку FCV может хорошо реплицироваться и вызывать значительный цитопатический эффект (CPE) in vitro, он широко используется исследователями в качестве суррогата вируса Norwalk (NV) [6].

Лишь недавно был секвенирован геном Felis catus, поэтому мало что известно о врожденном иммунитете кошек и взаимодействии FCV с врожденным иммунитетом кошек, что ограничивает понимание патогенеза FCV и других кошачьих вирусов [7].Неструктурный белок p39 штамма F4 FCV может подавлять продукцию IFN- β , предотвращая активацию IRF3 [8]. Между тем, наше более раннее исследование показало, что заражение FCV-2280 приводит к сильному высвобождению IFN- β , но другие штаммы FCV не действуют [7]. Кроме того, белок протеиназа-полимераза (PP) штамма FCV 2280 подавляет экспрессию репортерного гена люциферазы, управляемую эндогенными и экзогенными промоторами, что способствует ингибированию транскрипции клетки-хозяина [6].

FCV очень чувствителен к интерферонам, и IFN- β может подавлять инфекцию FCV. Лечение этими ИФН снижало вирусный выход FCV F9 [9, 10]. Кошачий IFN- ω продается в Японии (Toray Industries, Токио, Япония) и используется для лечения кошачьих калицивирусных и собачьих парвовирусных инфекций [11, 12]. Мы сообщали, что кошачий IFN- β может эффективно ингибировать репликацию штамма FCV 2280. Интерфероны (ИФН) являются компонентом раннего ответа на вторжение патогенов и индуцируют экспрессию сотен ИФН-стимулируемых генов (ИСГ) [13].Выявлены механизмы противовирусного действия некоторых ИСГ. Один из ключевых ферментов, участвующих в функционировании интерферонов (ИФН), 2′-5’олигоаденилат-зависимая рибонуклеаза L (РНКаза L), может разрушать одноцепочечные вирусные РНК [14]. Интерферон-индуцированный белок с тетратрикопептидными повторами 3 (IFIT3) ингибирует репликацию вируса РРСС в клетках MARC-145, опосредуя дцРНК-индуцированную продукцию IFN- β [15]. ISG20 представляет собой индуцируемую интерфероном 3′-5′-экзонуклеазу, которая ингибирует репликацию нескольких вирусов с положительной цепью РНК человека и животных, таких как вирус гепатита А, вирус гепатита С, вирус вирусной диареи крупного рогатого скота и вирус желтой лихорадки [16].Интерферон-стимулируемый ген 15 (ISG15) представляет собой убиквитин-подобный белок, который сильно индуцируется интерфероном I типа и действует как противовирусная и иммунорегуляторная молекула. Интерферон-индуцированный GTP-связывающий белок Mx1 может ингибировать различных представителей Rhabdoviridae, Paramyxoviridae, Orthomyxoviridae и Bunyaviridae, а также вирусы двухцепочечной ДНК, включая вирус гепатита B (HBV) и вирус африканской чумы свиней (ASFV) [17]. SAMHD1 ограничивает вирус простого герпеса 1 в макрофагах, ограничивая репликацию ДНК [18], и ограничивает обратную транскрипцию ВИЧ-1 в покоящихся CD4+ Т-клетках [19].Кроме того, ВИЧ чувствителен ко многим ISG, таким как APOBEC3G, TRIM5 α , тетерину и MX2 [20].

В то время как FCV чувствителен к интерферонам, ISG, которые могли бы ингибировать репликацию кошачьего калицивируса, не были идентифицированы. Здесь мы оценили противовирусную активность десяти кошачьих ISG (IRF1, РНКаза L, SAMHD, ISG15, ISG20, IFIT3, MX-1, GBP6, OASL и IRF2) против FCV с использованием метода транзиторной трансфекции и обнаружили, что кошачий IRF1 может эффективно подавляют репликацию FCV.Кроме того, мы обнаружили, что кошачий IRF1 может запускать выработку эндогенного интерферона и экспрессию ISG, предполагая, что IRF1 может положительно регулировать передачу сигналов IFN. Важно отметить, что уровни мРНК и белка IRF1 были снижены при инфицировании FCV, что может быть новой стратегией уклонения FCV от врожденной иммунной системы. Наконец, также была продемонстрирована противовирусная активность IRF1 в отношении вируса панлейкопении кошек, вируса герпеса кошек и вируса инфекционного перитонита кошек.

2.Материалы и методы
2.1. Вирусы и клетки

Клетки почек кошек Crandell Rees (CRFK) поддерживали в модифицированной минимальной основной среде Дульбекко (DMEM) (Gibco), содержащей 10% фетальной бычьей сыворотки (FBS, Gibco), 100 ЕД/мл пенициллина и 100 мкл г/мл стрептомицина. Штамм F9 FCV, штамм HR-1 FHV-1, штамм VR-638 FPV и штамм 2034 FPV размножали и титровали в клетках CRFK.

2.2. Плазмиды Конструкция

p3×Flag-IRF1, p3×Flag-РНКаза L, p3×Flag-SAMHD, p3×Flag-ISG15, p3×FlagISG20, p3×Flag-IFIT3, p3×Flag-MX-1, p3× Плазмиды Flag-GBP6, p3×Flag-OASL и p3×Flag-IRF2 экспрессируют кошачий IRF1, помеченный Flag (номер доступа: XM_003980752.4), RNase L (номер доступа: XM_006942762.2), SAMHD (номер доступа: XM_003983547.3), ISG15 (номер доступа: NM_001130843.2), ISG20 (номер доступа: XM_019831901.1), IFIT3 (номер доступа: XM_011287196 .2), MX-1 (номер доступа: XM_006935851.2), GBP6 (номер доступа: XM_0039.3), OASL (номер доступа: XM_003994734.3) и IRF2 (номер доступа: XM_019828250.1) соответственно. Плазмида pMyc-IRF1 экспрессирует IRF1 с Myc-меткой. Плазмида p3×Flag-IFN- β кодирует меченный Flag кошачий IFN- β , а плазмида pIFN- β -Luc содержит кассету экспрессии люциферазы (Luc), управляемую промотором кошачьего IFN- β . как описано ранее [7].Плазмида pISRE-TA-Luc экспрессировала репортерный ген люциферазы, находящийся под контролем элемента ответа на стимуляцию интерферона (ISRE). Плазмиду pRL-TK (Promega, Мэдисон, Висконсин, США), которая кодирует люциферазу Renilla, использовали в качестве внутреннего контроля для нормализации эффективности генной трансфекции. Плазмида pEGFP-IRF1 экспрессирует кошачий IRF1 с меткой EGFP. Грунтовки для построения IRF1 показаны в таблице 1.

9020 7
atttctagaCTACGGTGCACAAGGAATGGCCTGGAT attctcgaggtATGCCCATCACTCGGATGCG attctcgagATGCCCATCACTCGGATGCGC attgaattcgCGGTGCACAAGGAATGGCCT TGGGGCTRTCCATGTTGAT

Primer Последовательность (5′-3 ‘) Использование

Флаг-irf1-F attgcggccgcgATGCCCATCACTCGGATGCGCATGAGA Амплификация irf1
Флаг-irf1-R
Myc- irf1-F
Myc- irf1-R attgcggccgcCTACGGTGCACAAGGAATGG
GFP- irf1-F
GFP- irf1-R
Q-GAPDH-F TGACCACAGTCCATGCCATC QRT-ПЦР для обнаружения GAPDH
Q-GAPDH-R GCCAGTGAGCTTCCCGT ТСА
Q-FCV-F ATGATTTGGGGTTGTGATGT QRT-ПЦР для обнаружения FCV
Q-FCV-R
Q-irf1-F GGAAGTGAAGGACCAGAGC qRT- ПЦР для обнаружения irf1
Q-irf1-R TCCATCGGAGAAGGTATCA
qIFITM1 F CACCACCGTGATCAACATCCA QRT-ПЦР для обнаружения IFITM1
qIFITM1 R GACTTCACGGAGTAGGCAAAG
qViperin Р CATGACCGGGGCGAGTACCTG QRT-ПЦР для обнаружения Viperin
qViperin R GCAAGGATGTCCAAATATTCACC
qISG15 F TCCTGGTGAGGAACCACAAGGG QRT-ПЦР для обнаружения ISG15
qISG15 R TTCAGCCAGAACAGGTCGTC

2.3. Тест на люциферазу

Протокол этого анализа на люциферазу был описан ранее [7]. Вкратце, клетки CRFK (5×10 4 /лунку), выращенные в 48-луночных планшетах, котрансфицировали 0,5 мкг мкг/лунку репортерной плазмиды, 0,02 мк мкг/лунку плазмиды pRL-TK (Promega) (в качестве внутренний контроль для нормализации системы анализа) или указанную экспрессионную плазмиду. Клетки инфицировали SeV (100 единиц гемагглютинирующей активности на лунку) через 12 ч после котрансфекции. Клетки лизировали через 8-10 часов после инфицирования и измеряли активность люциферазы светлячка и Renilla с помощью системы репортерного анализа двойной люциферазы (Promega) в соответствии с протоколом производителя.Относительную активность люциферазы в каждом образце определяли по соотношению активностей люцифераз светлячка и Renilla.

2.4. Оценка противовирусной активности кошачьих ISGS

Вкратце, клетки CRFK (2×10 5 на лунку) высевали в 24-луночные культуральные планшеты на 24 ч, а затем трансфицировали 1 мкг мкг экспрессионных плазмид ISG или имитация трансфекции 1 мкг мкг p3×Flag-CMV-10. Штамм F9 FCV с множественностью заражения 0,01 инокулировали в клетки через 24 ч после трансфекции.Клеточный супернатант и клетки собирали для исследования вирусных титров и вирусной РНК, соответственно, через 24 ч после заражения.

2.5. Количественный анализ ОТ-ПЦР в реальном времени

Протокол количественной ОТ-ПЦР в реальном времени был описан ранее [21]. кДНК готовили с помощью набора для обратной транскрипции AMV (Takara, Япония) в соответствии с протоколом производителя. Количественную ПЦР в реальном времени, нацеленную на ген FCV и ген IRF1, проводили с использованием Agilent Mx3005P в соответствии с инструкциями производителя.Относительные уровни экспрессии мРНК рассчитывали методом 2-ΔΔCT с использованием GADPH в качестве внутреннего контроля для нормализации. Праймеры представлены в таблице 1.

2.6. Тест на титр вируса

Протокол титрования вируса был описан в нашем предыдущем исследовании [1]. Вкратце, с помощью DMEM без сыворотки готовили десятикратно разбавленные штаммы вируса, и 0,1 мл каждого разведения инокулировали в клетки, высеянные в 96-луночный культуральный планшет. После 1 ч адсорбции супернатант удаляли и 0.В каждую лунку добавляли 1 мл свежей DMEM, содержащей 1% FBS и 1% пенициллин-стрептомицин. ЦПД наблюдали через 72 ч после инокуляции, а титры вируса выражали как среднюю инфекционную дозу культуры ткани (TCID50)/мл по методу Рида и Мюнха [22].

В эксперименте по заражению FPV выход вируса определяли с помощью прямого флуоресцентного анализа (DFA) с использованием моноклональных антител против собачьего парвовируса, конъюгированных с FITC (CJ-F-CPV-MAB, VMRD).

2.7. Вестерн-блот-анализ

Клетки промывали холодным PBS и лизировали лизисным буфером RIPA (Институт биотехнологии Beyotime, Наньтун, Китай) с 0.1 мМ ФМСФ, затем лизаты очищали центрифугированием при 12 000 g в течение 5 мин при 4°С. Равные количества образцов белка разделяли с помощью 10% SDS-PAGE и переносили на нитроцеллюлозные мембраны (Millipore). Мембраны блокировали 5% обезжиренным молоком в течение 1-2 часов при комнатной температуре, а затем инкубировали в течение 1 часа при комнатной температуре с мышиным анти-FLAG M2 MAb (1804, Sigma), кроличьим поликлональным антителом против Myc (ab9106, Abcam). , кроличье моноклональное антитело против IRF1 (ab186384, Abcam), кроличье антитело против GADPH (ab22555, Abcam) и мышиное моноклональное антитело против FCV VP1 (произведено в нашей лаборатории).

После трех промываний в буфере TBST мембраны инкубировали при комнатной температуре в течение 1 ч с конъюгированным IRDye 800DX против кроличьего IgG или с IRDye 800-конъюгированным антимышиным IgG (1:8000; Rockland Immunochemicals), разбавленным TBST в качестве вторичного антитело. После третьей промывки мембраны визуализировали и анализировали с помощью системы инфракрасной визуализации Odyssey (LI-COR Biosciences).

2.8. Статистика

Значимые различия между экспериментальными группами определяли с помощью парного t -критерия и однофакторного ANOVA с Prism 5.0 (программное обеспечение GraphPad). Значение p <0,05 было выбрано для обозначения значимости.

3. Результаты
3.1. Скрининг кошачьих ISG, которые могут ингибировать репликацию FCV

Чтобы выяснить, какие кошачьи ISG могут ингибировать репликацию FCV, десять описанных кошачьих ISG с противовирусной активностью были клонированы в вектор p3×Flag-CMV10. Экспрессию этих кошачьих ISG с флаговой меткой идентифицировали вестерн-блоттингом с использованием антитела против флага (рис. 1(а)).Затем клетки CRFK трансфицировали пустым вектором или экспрессионной плазмидой ISG в течение 24 ч, а затем в клетки инокулировали штамм F9 FCV еще на 24 ч. Сначала мы проанализировали уровни вирусной РНК между группами трансфекции вектора и ISG. Экспрессия кошачьего IFN- β (положительный контроль), IRF1, РНКазы L и SAMHD значительно снижала уровни вирусной РНК по сравнению с таковыми в группе с векторной трансфекцией (рис. 1(b)). Среди этих ISG IRF1 был наиболее эффективным ингибитором и снижал продукцию вирусной РНК по меньшей мере на 80% (рис. 1(b)).Результат анализа титра вируса также показал, что экспрессия IRF1 значительно ингибировала выход вируса, но экспрессия РНКазы L и SAMHD не влияла на титры вируса в клеточных супернатантах (рис. 1(с)). Эти данные показали, что кошачий IRF1 (fe-IRF1) является мощным ингибитором FCV.

3.2. Сверхэкспрессия Fe-IRF1 ингибирует репликацию FCV дозозависимым образом

Чтобы исключить влияние вектора на репликацию FCV, fe-IRF1 был клонирован в другую эукариотическую экспрессирующую плазмиду pCMV-Myc, названную pMyc-IRF1.Клетки CRFK трансфицировали pMyc-IRF1 или пустым вектором. Через 24 часа после трансфекции клетки инокулировали FCV F9 при MOI 0,01 в течение 24 часов. Были проанализированы уровни вирусной РНК (рис. 2(а)) и титры (рис. 2(б)). Действительно, оба уровня были значительно подавлены, а также было обнаружено снижение экспрессии капсидного белка FCV VP1 с помощью fe-IRF1 (рис. 2(c)). Кроме того, IRF1 является важным ISG, и трансфицированная плазмида Fe-IFN- β может значительно увеличить экспрессию мРНК fe-IRF1 с 7.в 5 раз (рис. 2(г)). Более того, ингибирующий эффект IRF1 проявлялся дозозависимым образом (рис. 2(e)).

Затем мы сравнили кривую роста FCV в контрольных клетках и клетках, трансфицированных fe-IRF1. По сравнению с ложно-трансфицированными клетками выход вируса в клетках, трансфицированных fe-IRF1, был значительно ниже, чем в ложно-трансфицированных клетках в каждый момент времени (рис. 2(f)). Через 60 ч после заражения экспрессия fe-IRF1 приводила к снижению примерно на 2 log10TCID50/мл (рис. 2(f)).

На основании этих результатов мы пришли к выводу, что fe-IRF1 является эффективным антагонистом FCV.

3.3. Fe-IRF1 имеет общий консервативный ДНК-связывающий домен

IRF-1 является фактором регуляции транскрипции, и его N-концевые 125 аминокислот (N-125), кодирующие ДНК-связывающий домен (DBD), являются структурно и функционально консервативными среди Семейство белков IRF [23]. Мы проанализировали N-концевые 125 аминокислотных последовательностей IRF1 человека, мыши, свиньи, крупного рогатого скота, собаки, крысы и кошки с использованием MEGA5.0. Как показано на рис. 3(а), N-125 fe-IRF1 имеет 100% сходство с таковым человека, свиньи и собаки, предполагая, что N-125 fe-IRF1 консервативен.

Для изучения субклеточной локализации fe-IRF1 CDS fe-IRF1 были вставлены в pEGFP-N1 и названы pEGFP-IRF1. Конфокальная микроскопия показала, что слитый белок fe-IRF1 был локализован в ядре, что является той же субклеточной локализацией, что и другие IRF1.

3.4. Сверхэкспрессия Fe-IRF1 активирует IFN-
β и промоторы ISRE

В качестве важного сигнального фактора регуляции транскрипции IRF1 играет ключевую роль в активации ответов IFN I типа во время инфекций, вызванных вирусами и бактериями, а также в связи с другими реакциями [24]. ].Чтобы проверить, активирует ли fe-IRF1 сигнальный путь IFN- β , клетки CRFK котрансфицировали плазмидой fe-IRF1 и IFN- β (рис. 3(c)) или промотором ISRE (рис. 3(d)). репортер. Результаты показали, что сверхэкспрессия fe-IRF1 значительно повышала активность люциферазы по сравнению с клетками, трансфицированными пустым вектором, что свидетельствует о том, что fe-IRF1 активировал IFN- β и промотор ISRE. Фактически, трансфицированный fe-IRF1 может значительно повышать экспрессию мРНК ISG15 (в 500 раз), IFITM1 (в 40 раз) и Viperin (в 300 раз) (рис.С1).

Результаты показали, что fe-IRF1 является фактором положительной обратной связи в ответе IFN типа I, запуская IFN- β и нижестоящий сигнальный путь.

3.5. Инфекция FCV снижает экспрессию Fe-IRF1

IRF1 может индуцироваться вирусной инфекцией для элиминации вирусной инфекции [23]. Поскольку сверхэкспрессия fe-IRF1 может ингибировать пролиферацию FCV F9, мы хотели узнать, может ли инфекция FCV индуцировать экспрессию IRF1. Чтобы определить, увеличивалась ли экспрессия IRF1 при инфицировании FCV, клетки инфицировали различными MOI в диапазоне от 0.001 к 1, а затем через 24 часа после заражения оценивали уровни белка клеточного IRF1 и FCV VP1. Результат показал, что уровень белка эндогенного fe-IRF1 снижался при вирусной инфекции в зависимости от дозы вируса (рис. 4(а)).

Затем, чтобы выяснить, снижает ли инфекция FCV также снижение мРНК fe-IRF1, уровни мРНК fe-IRF1 проверяли с помощью количественного анализа RT-PCR в реальном времени. Мы обнаружили, что мРНК IRF1 также подавлялась при заражении FCV (рис. 4(b)).Эти результаты показали, что инфекция FCV приводила к снижению уровней как белка fe-IRF1, так и мРНК.

3.6. Fe-IRF1 может также ингибировать другие кошачьи вирусы

Чтобы выяснить, может ли fe-IRF1 также ингибировать репликацию других кошачьих вирусов, клетки F81, трансфицированные fe-IRF1, инокулировали с множественностью заражения 0,01 кошачьего герпесвируса (FHV), кошачьего вирус инфекционного перитонита (FIPV) и вирус панлейкопении кошек (FPV). Через 48 ч после инокуляции проверяли выход вируса. Результаты показали, что сверхэкспрессия fe-IRF1 может эффективно препятствовать репликации FPV (рис. 5(a)), FIPV (рис. 5(b)) и FHV (рис. 5(c)).Выход вируса снизился примерно на 1, 2,2 и 2 log (TCID50/мл) соответственно, что позволяет предположить, что fe-IRF1 обладает противовирусной активностью широкого спектра.

4. Обсуждение

Система IFN играет важную роль в индукции экспрессии антивирусных белков, кодируемых интерферон-стимулируемыми генами [25]. Продукты этих ISG обладают многочисленными противовирусными эффекторными функциями, многие из которых до сих пор полностью не описаны [26]. В этом исследовании десять кошачьих ISG были клонированы и успешно экспрессированы, и с помощью скринингового анализа мы обнаружили, что эктопическая экспрессия только fe-IRF1 может значительно ингибировать репликацию FCV.IRF1 является не только важным ISG, но и ключевым регуляторным фактором транскрипции [27] в регуляции транскрипции гена IFN- β [23]. Что еще более важно, заражение FCV может подавлять эндогенную экспрессию fe-IRF1, что предполагает новую стратегию уклонения от противовирусного ответа хозяина.

IRF1 — транскрипционный фактор, регулирующий врожденный и адаптивный иммунный ответ [28]. Семейство IRF включает факторы транскрипции, которые регулируют экспрессию интерферона (IFN) и IFN-стимулированных генов (ISG), связываясь с элементами их промоторов [29, 30].IRF1 был первым известным членом семейства IRF, активирующим промотор IFN- β , и было обнаружено, что он конститутивно экспрессируется на низком базальном уровне в большинстве типов клеток [31]. Идентифицированный IRF1 млекопитающих конститутивно локализован в ядре [32, 33], но некоторые гомологи IRF1 рыб не локализованы строго в ядре [34].

Мышиный IRF1 содержит две сигнальные последовательности ядерной локализации (NLS): 120RKERKSK и 132KSKTKRK. Было обнаружено, что последовательность из 24 аминокислот, содержащая обе последовательности, обеспечивает ядерную транслокацию IRF1 [35].N-концевые 125 аминокислот, кодирующие ДНК-связывающий домен (DBD), структурно и функционально консервативны среди белков семейства IRF [23]. Мы обнаружили, что fe-IRF1 имеет сигнальные последовательности для NLS и его домена DBD, которые также были консервативными. Мотив связывания консенсуса IRF1 (5′-G(A)AAA G/CT/C GAAA G/CT/C-3′ [36]) появляется в восходящем направлении от нескольких IFN-стимулируемых генов (ISG) и может сильно активировать IFN- β и промотор ISRE своим доменом DBD, который может усиливать экспрессию многих генов, таких как IFN- α / β , и многих генов ISG, таких как 2′, 5′-OAS, протеинкиназа R [ 23] и Виперин [37].Легко понять, почему IRF1 может эффективно ингибировать репликацию многих вирусов.

мРНК IRF1 повышается в ответ на интерфероны, двухцепочечную РНК (дцРНК), цитокины, некоторые гормоны [23] и вирусную инфекцию [38], а затем способствует экспрессии антивирусных белков и ограничивает репликацию многих вирусов [28, 38, 39]. Однако, чтобы подорвать врожденный иммунитет, многие вирусы развили стратегию подавления экспрессии IRF1 [40]. В этом исследовании мы обнаружили, что инфекция FCV приводила к снижению уровней как белка fe-IRF1, так и мРНК, что не согласовывалось с предыдущим сообщением о том, что свиной IRF1 постоянно увеличивался в клетках, инфицированных TGEV [38].Члены многих различных семейств вирусов ингибируют экспрессию генов-хозяев в процессе репликации вируса, влияя на транскрипцию, процессинг, транспорт и трансляцию мРНК [41]. Калицивирусы также разработали различные стратегии, чтобы подорвать или отрегулировать механизм синтеза белка хозяина в своих интересах [42]. Было показано, что штамм F9 FCV отключает синтез белка-хозяина путем расщепления эукариотических факторов инициации трансляции eIF4GI и eIF4GII [43], что может быть одним из факторов снижения экспрессии fe-IRF1.Тем не менее, ни в одном сообщении не описывается подавление мРНК гена хозяина, опосредованное инфекцией FCV, что является новой стратегией FCV для подавления противовирусного ответа хозяина. Точный механизм еще предстоит изучить.

В заключение мы впервые демонстрируем, что fe-IRF1 ингибирует репликацию FCV и других кошачьих вирусов. Мы также представили доказательства того, что инфекция FCV подавляет экспрессию IRF1 за счет снижения уровня мРНК fe-IRF1, что подчеркивает потенциальную стратегию уклонения от иммунного ответа для FCV.

Доступность данных

Данные, использованные для поддержки результатов этого исследования, можно получить у соответствующего автора по запросу.

Конфликт интересов

Авторы заявляют об отсутствии финансовых или коммерческих конфликтов интересов.

Вклад авторов

Юнсян Лю и Сяосяо Лю внесли равный вклад в эту работу.

Благодарности

Эта работа финансировалась Национальным фондом естественных наук Китая (грант №.31770172).

Дополнительные материалы

Рисунок S1 : fe-IRF1 повышает экспрессию мРНК ISG15, IFITM1 и Viperin. Клетки CRFK трансфицировали 500 нг/лунку pMyc-IRF1. Через 24 ч после трансфекции экспрессию мРНК ISG, IFITM1 и Viperin определяли методом qRT-PCR. Столбики погрешностей представляют собой стандартные отклонения, и каждый образец анализировали в трех экземплярах: P<0,05; : Р<0,01. (Дополнительные материалы)

ATP | Альфа-Тех Питомец

Кошачий калицивирус (FCV) проявляется у кошек, у которых помимо прочих симптомов наблюдаются выделения из глаз и/или носа, хромота, лихорадка и кровотечения из различных участков тела.Поскольку это очень заразная инфекция, важно содержать ветеринарную клинику, приют или помещение для животных в чистоте, особенно если вы подозреваете, что у кошки есть калифорнийский кашель. Наличие подходящего дезинфицирующего средства для домашних животных может помочь свести к минимуму распространение калицивируса, помимо быстрой изоляции зараженного питомца.

Что такое калицивирус?

FCV в первую очередь поражает дыхательную систему кошек, вызывая острые инфекции верхних дыхательных путей. Хотя есть и другие вирусы, которые могут вызывать это у кошек, FCV является одним из наиболее распространенных среди кошек во всем мире.

Что делает FCV таким вездесущим, так это тот факт, что он может легко распространяться. Восприимчивые к инфекции кошки могут заразиться при прямом контакте с инфицированной кошкой или при контакте с предметами, загрязненными выделениями инфицированной кошки, такими как капельки чихания. Более того, люди, которые прикасались к зараженным кошкам или зараженным предметам, могут невольно передать вирус уязвимым кошкам.

Кроме того, даже здоровые кошки могут быть носителями FCV, и выздоровление от болезни все еще может вызывать временное или постоянное носительство у ранее инфицированных кошек.Кошки-носители вируса также могут передавать это заболевание своим новорожденным пометам.

Дезинфицирующие средства против калицивируса

FCV может быть особенно проблематичным в средах с несколькими животными, таких как няни, грумеры, ветеринарные клиники и другие учреждения для домашних животных. Достаточно одной кошки, чтобы заразить целое облако, поэтому поддержание чистоты в помещении — это один из методов профилактики, который вы можете использовать. Это особенно важно для ветеринарных клиник, так как другие больные домашние животные присутствуют, а такие предметы, как кровати, игрушки, миски для еды и т. п., могут легко передавать FCV другим людям.

Для эффективной уборки ветеринарной клиники регулярно используйте ветеринарное дезинфицирующее средство. У Alpha Tech Pet есть линейка продуктов для тщательной ветеринарной дезинфекции, которая может защитить вольеры, другие предметы и помещения от 99,9999% бактерий.

Наше дезинфицирующее средство для домашних животных, специально разработанное для помещений для ухода за домашними животными. продукты могут убивать калицивирусы, удалять бактерии, вызывающие запах, и предотвращать размножение бактерий в питомниках. Наши дезинфицирующие средства для домашних животных выпускаются в различных формах, таких как:

  • Спреи
  • Порошки
  • Таблетки
  • Капсулы
  • Пены

Это позволяет выбрать тип дезинфицирующего средства, который лучше всего подходит для вашего учреждения по уходу за домашними животными.Барабаны, дозаторы мыла и генераторы озона также можно приобрести на нашем веб-сайте по уходу за животными, чтобы еще больше повысить качество санитарии в вашей ветеринарной клинике или центре по уходу за домашними животными.

Ключ к прекрасному здоровью

Несмотря на то, что FCV может быть обычным явлением среди кошек, снижение вероятности заражения всего клеща начинается со строгих санитарных правил. Держите свое учреждение по уходу за домашними животными или ветеринарную клинику надлежащим образом продезинфицированными с помощью дезинфицирующих растворов для домашних животных Alpha Tech Pet.

Для получения дополнительной образовательной информации обращайтесь к Тому Биссанти: [email protected] или посетите наш образовательный веб-сайт по индустрии домашних животных.

Эта запись не была размещена ни в одной категории.

Хоторнская больница для собак и кошек

Вакцины для кошек:

Если ваша кошка живет в помещении и никогда не выходит на улицу, мы рекомендуем только FVRCPC или вакцину против верхних дыхательных путей. FVRCPC расшифровывается как кошачий вирусный ринотрахеит, калици, панлейкопения и хламидиоз.

ВИРУСНЫЙ РИНОТРАХЕИТ КОШЕК:
Вирусная болезнь кошек, вызывающая чихание, инфекцию носовых ходов и глаз.Это заболевание вызывается вирусной инфекцией кошачьего герпеса. У кошек обычно появляются выделения из носа, которые могут перерасти в хроническую инфекцию пазух. Этот вирус может передаваться через плаценту во время беременности.

КАЛИЦИВИРУСНАЯ ИНФЕКЦИЯ КОШЕК:
Это распространенное респираторное вирусное заболевание, характеризующееся симптомами верхних дыхательных путей, язвами во рту и пневмонией. Вирус также может поражать глаза и вызывать конъюнктивит и язвы роговицы. У кошек обычно развиваются вторичные бактериальные инфекции, лихорадка и из-за заложенности носа они перестают есть.Вакцинация эффективна в профилактике этого заболевания.

ПАНЛЕЙКОПЕНИЯ КОШЕК:
Это острая вирусная кишечная инфекция, характеризующаяся внезапным появлением диареи, рвоты и депрессии. Этот вирус может поражать котят во время беременности и вызывать пороки развития головного мозга и глаз, а также вызывать гибель плода. Вакцинация очень эффективна в предотвращении этого заболевания.

ХЛАМИДИОЗ:
Хроническая респираторная инфекция у кошек, вызывающая сходные симптомы с калицивирусной инфекцией, но обычно без язв в полости рта, вызывающая легкое воспаление носовых ходов и верхних дыхательных путей.Также может присутствовать конъюнктивит (инфекция глаз). У молодых котят симптомы обычно более выражены.

Уличные кошки:

Если ваша кошка выходит на улицу, мы также рекомендуем провести тестирование и вакцинацию против вируса кошачьей лейкемии, а если у вас есть кошка, вируса иммунодефицита кошек.

ВИРУС ЛЕЙКЕМИИ КОШЕК:
Передается при случайном контакте, уходе за собой, использовании общей посуды или туалета. Также возможна передача котятам во время беременности и кормления грудью.